ID: 1047062985

View in Genome Browser
Species Human (GRCh38)
Location 8:121248943-121248965
Sequence ACCGTGTGCACACATTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047062985_1047062991 9 Left 1047062985 8:121248943-121248965 CCAGGAGAATGTGTGCACACGGT No data
Right 1047062991 8:121248975-121248997 AGGGAGCCCTTCAGCGACAGAGG No data
1047062985_1047062995 27 Left 1047062985 8:121248943-121248965 CCAGGAGAATGTGTGCACACGGT No data
Right 1047062995 8:121248993-121249015 AGAGGATGAGAGCTGCAGGATGG No data
1047062985_1047062994 23 Left 1047062985 8:121248943-121248965 CCAGGAGAATGTGTGCACACGGT No data
Right 1047062994 8:121248989-121249011 CGACAGAGGATGAGAGCTGCAGG No data
1047062985_1047062988 -10 Left 1047062985 8:121248943-121248965 CCAGGAGAATGTGTGCACACGGT No data
Right 1047062988 8:121248956-121248978 TGCACACGGTGGCCACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047062985 Original CRISPR ACCGTGTGCACACATTCTCC TGG (reversed) Intergenic
No off target data available for this crispr