ID: 1047063595

View in Genome Browser
Species Human (GRCh38)
Location 8:121255154-121255176
Sequence ATTAAGACACTGACATCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047063595_1047063598 0 Left 1047063595 8:121255154-121255176 CCCAAAGATGTCAGTGTCTTAAT No data
Right 1047063598 8:121255177-121255199 CTCTGGAACCTGTGAATACATGG No data
1047063595_1047063603 8 Left 1047063595 8:121255154-121255176 CCCAAAGATGTCAGTGTCTTAAT No data
Right 1047063603 8:121255185-121255207 CCTGTGAATACATGGTGGAGGGG No data
1047063595_1047063600 6 Left 1047063595 8:121255154-121255176 CCCAAAGATGTCAGTGTCTTAAT No data
Right 1047063600 8:121255183-121255205 AACCTGTGAATACATGGTGGAGG No data
1047063595_1047063604 9 Left 1047063595 8:121255154-121255176 CCCAAAGATGTCAGTGTCTTAAT No data
Right 1047063604 8:121255186-121255208 CTGTGAATACATGGTGGAGGGGG No data
1047063595_1047063601 7 Left 1047063595 8:121255154-121255176 CCCAAAGATGTCAGTGTCTTAAT No data
Right 1047063601 8:121255184-121255206 ACCTGTGAATACATGGTGGAGGG No data
1047063595_1047063599 3 Left 1047063595 8:121255154-121255176 CCCAAAGATGTCAGTGTCTTAAT No data
Right 1047063599 8:121255180-121255202 TGGAACCTGTGAATACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047063595 Original CRISPR ATTAAGACACTGACATCTTT GGG (reversed) Intergenic
No off target data available for this crispr