ID: 1047066113

View in Genome Browser
Species Human (GRCh38)
Location 8:121284948-121284970
Sequence AACAACTTGATGAAACTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047066111_1047066113 3 Left 1047066111 8:121284922-121284944 CCCAGAGGAATTAAAGGGGCAGA No data
Right 1047066113 8:121284948-121284970 AACAACTTGATGAAACTCACTGG No data
1047066112_1047066113 2 Left 1047066112 8:121284923-121284945 CCAGAGGAATTAAAGGGGCAGAA No data
Right 1047066113 8:121284948-121284970 AACAACTTGATGAAACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047066113 Original CRISPR AACAACTTGATGAAACTCAC TGG Intergenic
No off target data available for this crispr