ID: 1047078425

View in Genome Browser
Species Human (GRCh38)
Location 8:121431732-121431754
Sequence GTGTACATGTTCTGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047078420_1047078425 21 Left 1047078420 8:121431688-121431710 CCACTTTTGGCAGAGTCTTACTT No data
Right 1047078425 8:121431732-121431754 GTGTACATGTTCTGGAAGGAAGG No data
1047078419_1047078425 26 Left 1047078419 8:121431683-121431705 CCTTTCCACTTTTGGCAGAGTCT No data
Right 1047078425 8:121431732-121431754 GTGTACATGTTCTGGAAGGAAGG No data
1047078422_1047078425 -3 Left 1047078422 8:121431712-121431734 CCAGATGGACACTTCATTGAGTG No data
Right 1047078425 8:121431732-121431754 GTGTACATGTTCTGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047078425 Original CRISPR GTGTACATGTTCTGGAAGGA AGG Intergenic
No off target data available for this crispr