ID: 1047078600

View in Genome Browser
Species Human (GRCh38)
Location 8:121434056-121434078
Sequence CTGAGGTAACAGATGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047078594_1047078600 -6 Left 1047078594 8:121434039-121434061 CCTAAACCAACCTGATACTGAGG No data
Right 1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047078600 Original CRISPR CTGAGGTAACAGATGGAGTA GGG Intergenic
No off target data available for this crispr