ID: 1047083290

View in Genome Browser
Species Human (GRCh38)
Location 8:121488644-121488666
Sequence CTCAAACCATTCCAAAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047083288_1047083290 11 Left 1047083288 8:121488610-121488632 CCAAACGCTTAAAGAAGAACTAA No data
Right 1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047083290 Original CRISPR CTCAAACCATTCCAAAATAA TGG Intergenic
No off target data available for this crispr