ID: 1047085087

View in Genome Browser
Species Human (GRCh38)
Location 8:121507103-121507125
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047085087_1047085093 28 Left 1047085087 8:121507103-121507125 CCCACTAAACAGTGGTAGCACTG No data
Right 1047085093 8:121507154-121507176 TGTAAAAGTGCCTCATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047085087 Original CRISPR CAGTGCTACCACTGTTTAGT GGG (reversed) Intergenic
No off target data available for this crispr