ID: 1047085090

View in Genome Browser
Species Human (GRCh38)
Location 8:121507114-121507136
Sequence GTGGTAGCACTGAAAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047085084_1047085090 24 Left 1047085084 8:121507067-121507089 CCTGTAGTGCCTAGTAGGACAAA No data
Right 1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG No data
1047085083_1047085090 25 Left 1047085083 8:121507066-121507088 CCCTGTAGTGCCTAGTAGGACAA No data
Right 1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG No data
1047085085_1047085090 15 Left 1047085085 8:121507076-121507098 CCTAGTAGGACAAATCTGATTCA No data
Right 1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047085090 Original CRISPR GTGGTAGCACTGAAAATTGG TGG Intergenic
No off target data available for this crispr