ID: 1047092389

View in Genome Browser
Species Human (GRCh38)
Location 8:121588477-121588499
Sequence TGGGTGAATTTGGAGCTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047092389_1047092396 8 Left 1047092389 8:121588477-121588499 CCTATCAGCTCCAAATTCACCCA No data
Right 1047092396 8:121588508-121588530 TGCTCTGTGAAAATGGATGTGGG No data
1047092389_1047092395 7 Left 1047092389 8:121588477-121588499 CCTATCAGCTCCAAATTCACCCA No data
Right 1047092395 8:121588507-121588529 CTGCTCTGTGAAAATGGATGTGG No data
1047092389_1047092393 1 Left 1047092389 8:121588477-121588499 CCTATCAGCTCCAAATTCACCCA No data
Right 1047092393 8:121588501-121588523 TTTTTCCTGCTCTGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047092389 Original CRISPR TGGGTGAATTTGGAGCTGAT AGG (reversed) Intergenic
No off target data available for this crispr