ID: 1047096984

View in Genome Browser
Species Human (GRCh38)
Location 8:121636440-121636462
Sequence CAGTGGGACTGGAGAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 0, 2: 10, 3: 75, 4: 788}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047096984_1047096990 17 Left 1047096984 8:121636440-121636462 CCTTTTTCTCTCCAGTCCCACTG 0: 1
1: 0
2: 10
3: 75
4: 788
Right 1047096990 8:121636480-121636502 ACCCTTGAGCCAAGCTTCCAGGG No data
1047096984_1047096989 16 Left 1047096984 8:121636440-121636462 CCTTTTTCTCTCCAGTCCCACTG 0: 1
1: 0
2: 10
3: 75
4: 788
Right 1047096989 8:121636479-121636501 GACCCTTGAGCCAAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047096984 Original CRISPR CAGTGGGACTGGAGAGAAAA AGG (reversed) Intronic
900861050 1:5231663-5231685 CAGTGGCACTGCAGAGACAGTGG + Intergenic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901251157 1:7781545-7781567 GAGAGGGGCTGGTGAGAAAAGGG - Intergenic
901712969 1:11130168-11130190 AAGTGGAAGTGGAGAGAAAAAGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903353305 1:22731035-22731057 CAGAGGGGGCGGAGAGAAAATGG + Intronic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
905309082 1:37037196-37037218 CAGTGGGTGTGGAGAGCAAGAGG - Intergenic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906247572 1:44287879-44287901 CAGGGGGACTGGCCAGCAAAAGG + Intronic
906557761 1:46728151-46728173 CACTGGGACTGGTTAGAAAGTGG + Intergenic
906753319 1:48285768-48285790 CACTGGGACTGGTTAGATAATGG - Intergenic
907222263 1:52915558-52915580 CAGTGCTCCAGGAGAGAAAATGG + Intronic
907373443 1:54017636-54017658 CAGGTGGACAGCAGAGAAAAAGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908418010 1:63932291-63932313 GAGTGGGAATGGAGAGGAAGTGG + Intronic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909413687 1:75381370-75381392 CCTTGGGAATGGGGAGAAAAAGG + Intronic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
909708151 1:78611670-78611692 GAGTAGGAGTGGTGAGAAAAGGG - Intergenic
909807967 1:79894605-79894627 CATTGGGACTGGTCAGAAAGTGG - Intergenic
910223178 1:84909718-84909740 TCATGTGACTGGAGAGAAAAAGG + Intergenic
911321086 1:96414865-96414887 CAGTGGGAGTTGAAAGAATATGG + Intergenic
912022007 1:105117309-105117331 CTGTGGTACTGCAGAGAGAATGG - Intergenic
912032470 1:105265712-105265734 CACTGGGACTGGTTAGACAATGG - Intergenic
912118110 1:106432776-106432798 AAGTGGCATTGGAAAGAAAAAGG + Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912463770 1:109855216-109855238 CAGTGGGTATAGAGAGACAACGG + Intergenic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913420832 1:118667025-118667047 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
915401957 1:155628732-155628754 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
915669969 1:157479963-157479985 CAGTAAGAAAGGAGAGAAAAGGG - Intergenic
915935164 1:160086149-160086171 CAGTGGGAGAGAAGAGAAAGAGG - Intronic
916362780 1:163990092-163990114 CACTGGGACTGGTTAGACAATGG + Intergenic
916478513 1:165193403-165193425 GAATGGGAATGGAGATAAAAGGG - Intergenic
916633542 1:166642518-166642540 TAATGAGACTGCAGAGAAAAGGG + Intergenic
916679383 1:167090212-167090234 CCTGGGCACTGGAGAGAAAAGGG + Intronic
916829842 1:168479858-168479880 CAGTGAGATTGTGGAGAAAAAGG + Intergenic
917608679 1:176663804-176663826 CAGGAGAACTTGAGAGAAAATGG - Intronic
917764197 1:178199310-178199332 CATTGGGACTGGTCAGAAAGTGG - Intronic
917896824 1:179498935-179498957 TAGTGAGGCTGCAGAGAAAAAGG + Intronic
917981172 1:180270416-180270438 CAGGGGCACTGTGGAGAAAAGGG + Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918501584 1:185201581-185201603 CATTGGGACTGGTTAGACAAAGG - Intronic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919521196 1:198590487-198590509 CAGGGAGAATGGAGAGAAAGTGG - Intergenic
920711865 1:208302893-208302915 CAGTGGGGCTGGAGAGGTAGTGG + Intergenic
920969207 1:210728396-210728418 CAGTAGGACAGGTGATAAAAAGG + Intronic
921075463 1:211697074-211697096 GAGTGGGATGGGATAGAAAAGGG - Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922386863 1:225095026-225095048 CAGTGAGGTTGCAGAGAAAAGGG + Intronic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924284694 1:242474458-242474480 CAGTGGGAATTGAGAAGAAAGGG - Intronic
924746542 1:246839823-246839845 CAGTTGTACTGTAGAGAACAGGG + Exonic
924823196 1:247513842-247513864 CACTGGGACTGGTTAGAAAGTGG - Intronic
1063530481 10:6826244-6826266 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1064222887 10:13456439-13456461 CAGTGGGACTGGGGAGCGAGAGG + Intronic
1064348398 10:14554175-14554197 CAGTGGGAGGGTAGAGGAAAAGG - Intronic
1064364435 10:14694350-14694372 CGGTGAGAGTGCAGAGAAAAGGG - Intronic
1064478374 10:15715960-15715982 CAGTGGGAATGGCCTGAAAATGG - Intronic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065531794 10:26677618-26677640 AATTTGGACTGAAGAGAAAAAGG - Intergenic
1066062040 10:31732796-31732818 CACTGGGAGTGGAGAAAACAGGG - Intergenic
1066159571 10:32714211-32714233 CATTGGGACTGGTTAGAAAGTGG + Intronic
1067172621 10:43920769-43920791 CACTGGGACTGGTCAGAAAGTGG - Intergenic
1067209785 10:44250234-44250256 CACTGGGACTGGTTAGACAATGG - Intergenic
1067245647 10:44540170-44540192 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
1068030777 10:51702241-51702263 CAGTGGGACTAAAGAGAACATGG - Intronic
1068133966 10:52932069-52932091 AGGTGGGAATGGAGAAAAAAGGG + Intergenic
1068249347 10:54416758-54416780 CTGTGAGACTGTAGAGAAATAGG - Intronic
1068491495 10:57730228-57730250 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1068573815 10:58660774-58660796 CAGGAGGAGAGGAGAGAAAAGGG + Intronic
1068575069 10:58675945-58675967 CAGTGGGACTGGTTAGACAGTGG + Intronic
1070053625 10:72913293-72913315 CACAGGGACTGCAGAGAAAAAGG - Exonic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070851806 10:79570499-79570521 CACTGGGACTGGTCAGAAAGTGG + Intergenic
1070936712 10:80304165-80304187 CATTGGGACTGGTCAGAAAGTGG + Intergenic
1071873124 10:89816719-89816741 CAGTAGGACAGGGGAGAAGATGG - Intergenic
1072667693 10:97406260-97406282 CAGTGGGAAGGCTGAGAAAAGGG + Intronic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1073204534 10:101761951-101761973 CAGAGGGAATGGAAAGCAAAGGG - Intergenic
1073948832 10:108784011-108784033 CAGTTGGTCTGGAGAGCACATGG + Intergenic
1074463162 10:113657161-113657183 CGGGGAGAGTGGAGAGAAAAGGG + Intronic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075356239 10:121779475-121779497 CAGTGGGAGTGAAGATAAAACGG - Intronic
1075821157 10:125313112-125313134 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1075895832 10:125993926-125993948 CAGTGAGACAGGAGAATAAAAGG - Intronic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076325500 10:129617562-129617584 CGGTGAGGCTGTAGAGAAAACGG - Intronic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077826536 11:5815584-5815606 CAGTGAGAATGTAGAGAAATTGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077898027 11:6468671-6468693 CAGAGTGACTGAAGAGTAAATGG + Intronic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1078048472 11:7940267-7940289 CAGTTGGATTGGGAAGAAAATGG - Intergenic
1078056750 11:8015428-8015450 CAGTGGGAATGGAAACTAAAGGG + Intergenic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078150390 11:8754428-8754450 TAGTGAGACTGTAGAGAAATTGG + Intronic
1078474159 11:11616681-11616703 CAGTGGTACTAGAGACAAATAGG - Intronic
1079118234 11:17654215-17654237 CAGTGGGACAACTGAGAAAAAGG - Intergenic
1079696026 11:23483821-23483843 CATTGGGACTGGCTAGACAATGG + Intergenic
1080269846 11:30439626-30439648 AAGTGGCAGTGGAGACAAAAGGG + Intronic
1080461931 11:32462301-32462323 GAGGGGAACTGGAGAGAAGAGGG - Intergenic
1081118189 11:39231882-39231904 CATTGGGACTGGTTAGAAAGTGG + Intergenic
1081241464 11:40711200-40711222 CACTGGGACTGGTCAGAAAGTGG - Intronic
1081720397 11:45284910-45284932 CAGTGAGAGTGGAAAGGAAATGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082872231 11:57953864-57953886 CATTGGGACTGGATAGACAGTGG - Intergenic
1083393182 11:62370546-62370568 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1083593249 11:63907314-63907336 CAGGGGGTCTGGAGAGAGCAGGG + Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1085236684 11:75020787-75020809 CAGTGGGACTGGGGCAATAAGGG + Intergenic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1086259166 11:84916795-84916817 CAGTGTGGCTGAAGAGAGAAAGG - Intronic
1086595807 11:88569263-88569285 CAGTTAGACTTGAAAGAAAATGG + Intronic
1087233535 11:95693164-95693186 TAGCGAGACTGCAGAGAAAAGGG + Intergenic
1087635609 11:100697864-100697886 CGGTGGGAGTGGAGAGCAAGGGG + Intronic
1087724504 11:101702440-101702462 CCTTGGGAATGGGGAGAAAAAGG + Intronic
1087795302 11:102450132-102450154 GAGTGGCAATGGAGATAAAAGGG - Intronic
1087831066 11:102820247-102820269 CATTGGGACTGGTTAGACAATGG - Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089413975 11:118271575-118271597 GAGTGTGAGTGGAGAGAAAAGGG + Intergenic
1089471368 11:118723078-118723100 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1090188956 11:124756123-124756145 CACAGGGACTGGGGTGAAAAGGG - Intronic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090685213 11:129109557-129109579 CAGTGAGTATGCAGAGAAAAGGG - Intronic
1090826605 11:130391584-130391606 CTTGGGGACTGGAGAGAAAGCGG + Intergenic
1090826678 11:130392172-130392194 TAGTGAGACTGGAGAGCGAAAGG - Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091050484 11:132364246-132364268 CAGTGATACAGGAGACAAAAAGG + Intergenic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091090125 11:132763144-132763166 CATTGGGACTGGTTAGACAATGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1091528180 12:1327555-1327577 CAGTTGTAAGGGAGAGAAAAAGG - Intronic
1092062258 12:5561097-5561119 CAGTGGGCCTGGAGATAGCACGG + Intronic
1092798210 12:12135354-12135376 AAGTGGGAGAGAAGAGAAAAAGG + Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1092950071 12:13494083-13494105 CAGTGAGAATATAGAGAAAAGGG - Intergenic
1093092877 12:14941035-14941057 CTGTGAGACTGCAGAGAAAAGGG + Intergenic
1093829987 12:23744180-23744202 GAATGGGACTGGGGAGAATATGG - Intronic
1093835700 12:23825404-23825426 CAGTGGGACTGGTTAGACAGTGG - Intronic
1093992934 12:25610345-25610367 CATTGGGACTGGTCAGAAAGTGG - Intronic
1094313646 12:29114132-29114154 TAGTGGGAATAGAAAGAAAAGGG + Intergenic
1094874143 12:34622056-34622078 CATTGGGAATGGTGACAAAAAGG - Intergenic
1095130103 12:38531011-38531033 GGTTGGGACTGTAGAGAAAAGGG - Intergenic
1095177250 12:39107171-39107193 CAGGGAAACTGGAGAGGAAATGG - Intergenic
1095817623 12:46441660-46441682 GAGTGGAACTGGATAGAAAAAGG + Intergenic
1095845207 12:46737097-46737119 CACTGGGACTGGTCAGAAAGTGG + Intergenic
1096253366 12:50047835-50047857 CAGTGGCAATGGAAATAAAAAGG - Intergenic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1096828059 12:54294520-54294542 CAGAGGGACTGAAGAGGAGAAGG - Intronic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097015680 12:55985286-55985308 TAGTGGGACTGGAGTTAAACTGG - Intronic
1097295286 12:57956443-57956465 CAGTGGGAAAGATGAGAAAATGG + Intronic
1097330673 12:58329525-58329547 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1097898893 12:64853821-64853843 CACTGAGACTGGTTAGAAAATGG - Intronic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1097989028 12:65815020-65815042 CAGTGGGACTGCTCTGAAAAGGG + Intergenic
1098080848 12:66784061-66784083 CAGAGGGACAGCAGGGAAAATGG + Intronic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099338679 12:81398503-81398525 CAGGGGGATTGGAGATAAACAGG - Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099651838 12:85438552-85438574 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
1099862255 12:88234965-88234987 CAGTGGGATAGGGGAGAAACAGG - Intergenic
1100158149 12:91826060-91826082 CAGTGGAACTAGAGAACAAAAGG - Intergenic
1100631276 12:96391737-96391759 TAGTGAAAATGGAGAGAAAAGGG - Intronic
1100768832 12:97898632-97898654 CACTGGGACTGGTTAGACAATGG - Intergenic
1100784172 12:98061660-98061682 CAATGGGAAAGGAGAGACAAAGG + Intergenic
1100849347 12:98693023-98693045 CAGGGAGGCTGCAGAGAAAAGGG - Intronic
1101157918 12:101944963-101944985 CAAAGGGACAGGATAGAAAAGGG - Intronic
1103408396 12:120692493-120692515 CAGAGGGACTGATGAGACAATGG - Intronic
1103916708 12:124379525-124379547 CAGGGGGACTGGAAAGACACTGG + Intronic
1104175424 12:126326656-126326678 CACTGGGACTGGTCAGAAAGTGG - Intergenic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1104775529 12:131388173-131388195 GAGAGGGACAGCAGAGAAAAGGG + Intergenic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1105947629 13:25203086-25203108 CAGAAGGAAGGGAGAGAAAATGG + Intergenic
1106042056 13:26103059-26103081 CACTGGGACTGGATAGAGAGTGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1108473841 13:50793486-50793508 TAGTGAGGCTGCAGAGAAAAGGG - Intronic
1108691461 13:52862868-52862890 CAGAGGGGCAGGAGAGAAAGGGG + Intergenic
1109459816 13:62641823-62641845 CACTGGAACTGGATTGAAAATGG - Intergenic
1110974798 13:81817576-81817598 TGGTGAGGCTGGAGAGAAAAGGG + Intergenic
1111192311 13:84825479-84825501 TGGTGGGGCTGCAGAGAAAAGGG - Intergenic
1111670384 13:91322206-91322228 CAGTGCAAGTGGAAAGAAAAAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111858087 13:93665682-93665704 GAGTGGGACAGAAGAGATAATGG + Intronic
1112461100 13:99604543-99604565 GAGTGGGGCTGGAGATAAATTGG + Intergenic
1112785764 13:102950542-102950564 CAGTGGGACTTGGGAGACGAAGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595241 13:111527053-111527075 CAGTGGGCCTGGACAGAAACCGG + Intergenic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1113868834 13:113545960-113545982 CAGTGGGGCTGGAGATGAAGGGG + Intronic
1114126747 14:19736588-19736610 TAGTGAGAATGCAGAGAAAAGGG - Intronic
1114337250 14:21703278-21703300 CAATGAGAATGGAGAGGAAAGGG + Intergenic
1114603740 14:23978535-23978557 CACTGGGACTGGTGAGACAGTGG + Intronic
1114608752 14:24021309-24021331 CACTGGGACTGGTGAGACAGTGG + Intergenic
1114741662 14:25104376-25104398 CAATGGGACTGGTGAGACAGTGG + Intergenic
1115294712 14:31812642-31812664 CACTGGGACTGGTGTGAAAGTGG - Intronic
1115424304 14:33238387-33238409 CTGTGGGACTACAGAGAGAATGG - Intronic
1115721187 14:36162558-36162580 CATTGGGACTGGTGAGACAGTGG - Intergenic
1116026332 14:39519923-39519945 TGGTGGGACTGCAGAGAAAAAGG + Intergenic
1116395307 14:44441500-44441522 CGGTGAGGCTGCAGAGAAAAAGG + Intergenic
1116403623 14:44541234-44541256 CGGTGAGGCTGCAGAGAAAAAGG + Intergenic
1116648445 14:47560032-47560054 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
1117237886 14:53798017-53798039 CATTGGGACTGGTTAGAAAGTGG + Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117563095 14:56965102-56965124 CAGTGTGACAGGAAAGCAAAGGG + Intergenic
1117655385 14:57951113-57951135 CATTGGGACTGGTTAGACAATGG + Intronic
1118006397 14:61567947-61567969 TAGTGGGACTGGAGAGCGCAAGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119535025 14:75395939-75395961 GAGGGGGAGTGGGGAGAAAAGGG + Intergenic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119847942 14:77844627-77844649 CATTGGGACAGGGGAGAAAATGG + Intronic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1120769939 14:88368042-88368064 CAGTGAGGTTGTAGAGAAAAAGG - Intergenic
1120841649 14:89090898-89090920 CAGTAGGAATGAAGAGAAACAGG - Intergenic
1121436695 14:93925331-93925353 CAGAAGGCCTGGGGAGAAAAGGG + Exonic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121859048 14:97299340-97299362 CAATGGGGATGGAGAGAGAAGGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1123570272 15:21598802-21598824 CAGTAAGAATGCAGAGAAAAGGG - Intergenic
1123606383 15:22034122-22034144 CAGTAAGAATGCAGAGAAAAGGG - Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124008924 15:25819431-25819453 TGGTGAGACTGCAGAGAAAAGGG + Intronic
1124088864 15:26579000-26579022 AAGTGGCACTGCATAGAAAAAGG + Intronic
1124682893 15:31751421-31751443 CAGTGAGGCTACAGAGAAAAGGG + Intronic
1125362314 15:38877047-38877069 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126287690 15:47032919-47032941 CAGTGAGAATGTAGAGAAAAGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126787187 15:52186800-52186822 CCCTGGGGCTGGAGAGATAATGG + Intronic
1127369792 15:58328880-58328902 CAGTGAGATTGCAGAGAAAAGGG + Intronic
1128403230 15:67307520-67307542 GAGTGGGAGTGGAGAAAGAAGGG + Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129716522 15:77854901-77854923 CAGTGGGACCACAGAGATAAAGG - Intergenic
1130114628 15:80996048-80996070 AAGTGGGGCTGGGGAGGAAATGG + Intergenic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130723947 15:86419276-86419298 CATTGGGACTGGTTAGAAAGTGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130990763 15:88874354-88874376 CAGTGGACCTGGAAAGAAAGTGG - Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131838571 15:96414115-96414137 AATTGGAGCTGGAGAGAAAAGGG + Intergenic
1132185332 15:99798331-99798353 AAGTGGGGCTGGAAAGGAAAGGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1202978623 15_KI270727v1_random:325893-325915 CAGTAAGAATGCAGAGAAAAGGG - Intergenic
1133085167 16:3356551-3356573 TAGTGGGACTGCAGTGAAGAAGG - Exonic
1133449608 16:5892731-5892753 CAGGGGTAGTGGGGAGAAAATGG + Intergenic
1133722627 16:8509014-8509036 CGGTGGGGCTGCGGAGAAAAGGG + Intergenic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1134491546 16:14699580-14699602 CAGTGGCACTGGGGACCAAAAGG - Intergenic
1134496927 16:14738698-14738720 CAGTGGCACTGGGGACCAAAAGG - Intronic
1135432063 16:22393194-22393216 CAGATAGACTGCAGAGAAAAGGG - Intronic
1135481890 16:22827488-22827510 CAGTGGTGGTGGAGAGAGAAAGG + Intronic
1135728564 16:24875892-24875914 CAGAGGGAATTGGGAGAAAATGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136930520 16:34414115-34414137 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1136974054 16:34997693-34997715 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1137637821 16:50002428-50002450 CAGTTGGAAGGGAGAGAACAGGG + Intergenic
1137828034 16:51516740-51516762 CACTGGGACTGGATAGACAGTGG + Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138315679 16:56068050-56068072 CCCTGGGGCTGGAGAGACAATGG + Intergenic
1138386055 16:56636273-56636295 CAGTGTGAGTGGAGAGGACATGG + Intergenic
1138429618 16:56960560-56960582 GGCTGGGCCTGGAGAGAAAAGGG - Intergenic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138541935 16:57693544-57693566 AAGTGGGTATGAAGAGAAAAAGG + Intergenic
1139278305 16:65748462-65748484 CAGTGAAGCTGGAGAGGAAAGGG - Intergenic
1141485593 16:84337757-84337779 CAGTCAGACGAGAGAGAAAAAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1143451141 17:7037396-7037418 TAATGGGACTGGAGTGTAAAAGG + Intronic
1143991746 17:10969870-10969892 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146058227 17:29591608-29591630 GCCTGGGACTGGAGATAAAAGGG + Intronic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1146788249 17:35736198-35736220 GAGAGGGAGTGGAGAGAAAAAGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147454835 17:40530715-40530737 GAGTGGAACTGGAGAGGGAAGGG + Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148039058 17:44691618-44691640 TAAAGGGACTGGAGGGAAAAAGG + Intergenic
1150150705 17:62807278-62807300 TACTGTGACTGCAGAGAAAAAGG + Intronic
1150250909 17:63704040-63704062 CACTGGGCCTGGAGGGAAAGGGG + Exonic
1150439408 17:65179189-65179211 AAGTGGGAGGGGAAAGAAAAAGG + Intronic
1150532604 17:66000201-66000223 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1153059466 18:980424-980446 CATTGGGACTGGTTAGAAAGTGG - Intergenic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1153864397 18:9250397-9250419 TAGTGGGAATAGAGAGAAAACGG + Intronic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156335418 18:36167201-36167223 CACTGGGAGTCGAGACAAAAAGG + Exonic
1156357406 18:36354092-36354114 CTGTGTGCCTGGGGAGAAAAGGG + Intronic
1156825249 18:41423340-41423362 AAGAGGGACTGGAGAAAAAAAGG - Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157457238 18:47843377-47843399 AAGTGGGACAGGGGAGAACAGGG - Intronic
1157706510 18:49812523-49812545 CAGTGTAATTGGGGAGAAAAGGG - Intronic
1158304985 18:56095414-56095436 CAGTGGGAAGGGACAGATAAAGG + Intergenic
1158499424 18:57986850-57986872 GAGTGGGACTGGAGAAAAAGGGG - Intergenic
1158665841 18:59431846-59431868 GAGTGGGGCTGCAGAGAGAATGG - Exonic
1158801039 18:60909657-60909679 CAGTGAGAATGTAGAGAAACAGG + Intergenic
1158839194 18:61365308-61365330 CAGTGGGACCCGACAGAAGATGG - Intronic
1159111320 18:64059551-64059573 TGGTGAGACTGCAGAGAAAAGGG - Intergenic
1159304799 18:66626761-66626783 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1161217356 19:3101095-3101117 CAGTTTGACAGAAGAGAAAACGG - Intronic
1162059071 19:8083776-8083798 TAGTAGGACTGGGGAGGAAATGG - Intronic
1163025373 19:14508019-14508041 CAGTGGGGCAGGAGAGACAACGG - Intergenic
1163297649 19:16422503-16422525 ATGAGGGAGTGGAGAGAAAAAGG + Intronic
1164370510 19:27639683-27639705 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165184315 19:34003841-34003863 GAGTAGGACTGCAGAGAAACAGG - Intergenic
1165305382 19:35000160-35000182 GAGAGGGACTGGACAGAGAAGGG - Intronic
1165417360 19:35702974-35702996 GAGTGGGACAAGAGAGAAAAGGG + Intergenic
1165460964 19:35944269-35944291 TGGTGGGACTAGAGTGAAAATGG + Intronic
1165606402 19:37108695-37108717 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1166163733 19:40971475-40971497 CACTGGGACTGGTCAGAAAGTGG - Intergenic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
1167153790 19:47725786-47725808 GAGTGGGAGTGGAGAGACAGGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167687002 19:50962688-50962710 CAGTGGGAAGGCAGAGACAATGG - Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
925920628 2:8635365-8635387 CTGTGGGCCTTGACAGAAAAAGG - Intergenic
926051101 2:9745269-9745291 CAGTGGGTGTGGGGAGGAAAGGG - Intergenic
926384835 2:12325783-12325805 CAGTCCCACAGGAGAGAAAAGGG + Intergenic
926693212 2:15751655-15751677 CAGAGGGAATGTAGAGTAAAGGG + Intergenic
926901509 2:17755335-17755357 AAGTGAGACTGCAGATAAAAAGG - Intronic
927182708 2:20458415-20458437 CATTGGGACTGGTTAGACAATGG + Intergenic
927317415 2:21701128-21701150 GAGTGGAACTGAAAAGAAAAAGG - Intergenic
927408621 2:22800303-22800325 CTGGGGGACTTGAAAGAAAATGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927910279 2:26892990-26893012 GAGTTGGACTGGAGAGACTAGGG - Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928570976 2:32608387-32608409 CAGAGGGAGAGGAGAGGAAAAGG - Intronic
928592333 2:32830352-32830374 TGGTGAGACTGCAGAGAAAAGGG + Intergenic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
930151508 2:48064850-48064872 CATTGGCAATGGAAAGAAAATGG - Intergenic
930875780 2:56213997-56214019 CAGTGAGGCTGGAGAGACATTGG + Intronic
931667275 2:64618326-64618348 CAGTGGGGCAGGAGAGAGCAGGG + Intergenic
931946387 2:67313237-67313259 TAGTGGGACTGGAGACAATATGG - Intergenic
932465590 2:71922153-71922175 TGGGGGGACTGGAGAGAAGAGGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933564255 2:83930617-83930639 TAGTGGGACTGCAGATCAAATGG - Intergenic
933613385 2:84459617-84459639 CAGTGAGACCGGGGAGACAAGGG + Intronic
933860337 2:86460381-86460403 CAGGAGGGCTGGAGAGATAAAGG + Intronic
934019307 2:87928681-87928703 TGGTGAGACTGTAGAGAAAAGGG - Intergenic
934685104 2:96315425-96315447 CTGTGGGACTTGAGAGAGCAAGG + Intergenic
934775529 2:96934822-96934844 CAGGGTGAGTGGGGAGAAAAAGG - Intronic
935412974 2:102785276-102785298 GAGTGGGACTGGCCTGAAAATGG - Intronic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936039303 2:109137656-109137678 CAGAGATACTGGAGAGAAAGAGG + Intronic
936060619 2:109293476-109293498 CACTGGCAGTGGAGAGAGAAGGG - Intronic
936287986 2:111196233-111196255 CAGAGGGACAGGAAAAAAAAAGG - Intergenic
936640368 2:114304634-114304656 CAGTGGGACTGGTTAGACAGTGG - Intergenic
937134534 2:119541562-119541584 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937319249 2:120951228-120951250 CAGGGGGCCTGCAGAGACAATGG - Exonic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937769751 2:125706561-125706583 CAGTGAGGCTGAAGAGAAATAGG + Intergenic
938144650 2:128823499-128823521 CACTGGGACTGGTTAGACAATGG + Intergenic
938270262 2:129964024-129964046 CATTGGGAATGGGGAGAAAAAGG - Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
938970692 2:136428543-136428565 GAGTGGAATTGGAGAGGAAAAGG + Intergenic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939383381 2:141465305-141465327 GAGTGTGAGGGGAGAGAAAAAGG + Intronic
939706428 2:145458920-145458942 CAGTGGAGCTGGTGAGAACAAGG + Intergenic
939730791 2:145782505-145782527 CATTGGGACTGGTCAGAAAGTGG + Intergenic
940086132 2:149861198-149861220 CAGGAGGAATAGAGAGAAAAGGG + Intergenic
940408174 2:153329134-153329156 CATTGGGACTGGTTAGAAAGCGG - Intergenic
940719178 2:157262759-157262781 CTTTGGGACTCCAGAGAAAACGG - Intronic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
940998928 2:160180799-160180821 CACTGGGACTGGTTAGACAATGG + Intronic
941004039 2:160229238-160229260 TAGTAGGACTGGATATAAAATGG - Intronic
941023727 2:160438114-160438136 CAGTGCTACTGAAAAGAAAAAGG - Intronic
941118454 2:161499902-161499924 CAGTTGTACTGTAGAGAACAGGG + Intronic
941267652 2:163382886-163382908 TAGTGAGGCTGCAGAGAAAAAGG - Intergenic
941391778 2:164923823-164923845 TAGTGGGGCTGTGGAGAAAAGGG + Intronic
942174355 2:173317357-173317379 AAGTGGGACTGCAAAGAAGAAGG - Intergenic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
942865326 2:180666668-180666690 TGGTGGGAGTGGGGAGAAAAGGG + Intergenic
943456034 2:188108358-188108380 TAGTGAGACTGTGGAGAAAAAGG + Intergenic
943458109 2:188133045-188133067 CAGTGGAACTGGGAAGAAGATGG + Intergenic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
944157356 2:196621395-196621417 CTGTGAGACAGGACAGAAAATGG - Intergenic
944393638 2:199245601-199245623 CATTGGGACTGGTCAGAAAGTGG - Intergenic
945083135 2:206106184-206106206 CACTTGGATGGGAGAGAAAATGG + Intergenic
945199507 2:207267063-207267085 AAGTGGGAGTGGGGAGACAATGG + Intergenic
945273010 2:207960642-207960664 TAATGGGAGTGGAGAGGAAAGGG + Intronic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
945326586 2:208489219-208489241 CAGAGAGAGTGCAGAGAAAAAGG - Intronic
945378438 2:209108946-209108968 CAGTGAGAATGTGGAGAAAAGGG + Intergenic
945512133 2:210715512-210715534 CAGAGGCACTTGAGAGATAAAGG + Intergenic
945865817 2:215174166-215174188 CAGTGTGAATGTAGATAAAAAGG + Intergenic
946310669 2:218880930-218880952 CAGTGGGACTGGAGAGCCAGGGG - Exonic
946353244 2:219169152-219169174 GAGTGGGACTGTAGAGCAATGGG - Intronic
946684763 2:222256468-222256490 CAGTGGGAGTGGAGAGGGAGAGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948618148 2:239214841-239214863 GCATGGGACTGGAGAGAAATAGG + Intronic
948920994 2:241065869-241065891 AAGTGGGACTGGGGAGGAATGGG + Intronic
949080390 2:242093323-242093345 GAGTTGGACTAGAGAGAAAGAGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1169174975 20:3502979-3503001 CAGTATCACTGGAGTGAAAAAGG - Intronic
1169320146 20:4625652-4625674 CACTGGGACTGGTTAGACAATGG - Intergenic
1169347188 20:4838113-4838135 CAGTGGATGTGGAGAGACAAGGG + Intergenic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170781168 20:19426843-19426865 CAGTGGGACTGGGGAGTGAGAGG + Intronic
1170815563 20:19710992-19711014 CAGTGAGACTGCATAGCAAAGGG - Intronic
1171437465 20:25134501-25134523 CACTGGGTCTGGAAAGAGAATGG + Intergenic
1171854671 20:30333501-30333523 CAGAGGGACTAGGGAGAAAGTGG - Intergenic
1171960866 20:31493124-31493146 CAGTGGGACTGGGAAGAGGATGG - Intergenic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1174325971 20:49779185-49779207 CAGGGGGACTTGGGAGAAAATGG + Intergenic
1174530346 20:51207510-51207532 CACTGAGACTCAAGAGAAAATGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175778792 20:61669224-61669246 CTGTGGGCCTGGAGAGTTAAAGG + Intronic
1175933522 20:62504621-62504643 CAAAGGGACAGGACAGAAAAGGG - Intergenic
1176301137 21:5099576-5099598 CCCTGGGAGTGGAGAGGAAACGG + Intergenic
1177113949 21:17063169-17063191 CAGTGGGATAGGAGACAGAAAGG + Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1178039947 21:28629229-28629251 CAGTGAGACTTTAGAGAAAGAGG - Intergenic
1178598657 21:33977136-33977158 AATTAGGACTGGAAAGAAAACGG + Intergenic
1179437957 21:41374984-41375006 CAGTGTGACTGGTGAAAAAGAGG - Intronic
1179855892 21:44162322-44162344 CCCTGGGAGTGGAGAGGAAACGG - Intergenic
1180024811 21:45154965-45154987 CAGTGGGAGGGGAGAGAGATGGG + Intronic
1180838489 22:18945764-18945786 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1181001092 22:19988062-19988084 CAGTGGGTCTGGCAAGAGAAAGG + Intronic
1181037713 22:20177970-20177992 CACTGGGACTGGTGGGAAACTGG + Intergenic
1181390178 22:22574616-22574638 CAGTGGGACTGGGGAAAGAGAGG + Intergenic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183102712 22:35593665-35593687 GAGAGGGAAAGGAGAGAAAAGGG + Intergenic
1183239719 22:36648595-36648617 CAGGGGCCCTGGAGAGAGAAGGG - Intronic
1183387673 22:37524472-37524494 CTATGGGACTGGGGAGAGAAGGG + Intergenic
1184640702 22:45868487-45868509 ACGTGAGACTGGAGAGAAAGAGG - Intergenic
1184925470 22:47633369-47633391 GAGTGGGTCTGCAGAGAAACCGG + Intergenic
1184974433 22:48051078-48051100 CAGCATGACTGGAGAGAAATGGG + Intergenic
1185022490 22:48387117-48387139 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
949393754 3:3592580-3592602 CAGTGAGGTTGTAGAGAAAAAGG + Intergenic
949475666 3:4442616-4442638 TAGAGGGACAAGAGAGAAAAAGG + Intronic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
949628155 3:5891348-5891370 CTGTGGGACTAGGGAGTAAATGG + Intergenic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950030544 3:9849741-9849763 CCCTGGGAATGGGGAGAAAAAGG - Intronic
950194278 3:10998300-10998322 CTGTGAGGCTGGGGAGAAAAGGG + Intronic
950531221 3:13553306-13553328 GAGTGGGCCTGGAGAGGACAAGG + Intronic
950608132 3:14102871-14102893 CAGTGAGGCTGCAGAGAAAATGG + Intergenic
950626765 3:14253110-14253132 TTGTGGGACTGGGGAGAAACTGG + Intergenic
950991938 3:17449047-17449069 CATTGGGACTGGTTAGAAAGTGG + Intronic
951430002 3:22595791-22595813 GTGTGGGACAGGAGAGAGAAAGG + Intergenic
951508655 3:23477927-23477949 CAGAGTGACAGGAGAGAGAAGGG - Intronic
951629204 3:24699799-24699821 CATTGGGACTGGATAGAAAGTGG - Intergenic
951693947 3:25426698-25426720 CAGAGGCAGTGGAGAAAAAAGGG + Intronic
951866580 3:27315332-27315354 CAGGAGGCCTTGAGAGAAAAAGG - Intronic
953606423 3:44415852-44415874 CAGTGGGACAGCAGAGAACTTGG + Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954495651 3:50958090-50958112 CAGTGGGACTGGACAAAGACAGG - Intronic
954571883 3:51647932-51647954 CACTGGGACTGGTTAGACAATGG + Intronic
955907844 3:63826367-63826389 CAGTGGGAATGGGGAGATAAAGG + Intronic
956048393 3:65220736-65220758 CACTGGGACTGGTCAGAAAGTGG - Intergenic
956176661 3:66479218-66479240 CAGAGGAAATGCAGAGAAAACGG + Intronic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956839105 3:73120698-73120720 AAATTGGACTGGGGAGAAAAAGG + Intergenic
956929536 3:74027347-74027369 CAGTTACACTGGCGAGAAAACGG - Intergenic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957642759 3:82879147-82879169 CCTTGGGACTGTAGACAAAAGGG + Intergenic
957677616 3:83390482-83390504 CATTGGAATTGGAAAGAAAAGGG - Intergenic
958121073 3:89289282-89289304 CAGTGGGAATAAAGAGTAAAAGG - Intronic
958495042 3:94834316-94834338 CAGTGAGGTTGCAGAGAAAAGGG + Intergenic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
958743194 3:98099676-98099698 CAATGGGTCTGGAGAGAAACTGG + Intergenic
959060038 3:101608318-101608340 CAGAGGGAGGGGAGAGAAAAAGG - Intergenic
959070626 3:101698930-101698952 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
959492750 3:107011224-107011246 CAGTGAGAATGTATAGAAAATGG + Intergenic
959494351 3:107032055-107032077 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
959897785 3:111624658-111624680 CAGTGGGAATCGAGAGTGAAGGG + Intronic
959974385 3:112442050-112442072 TGGTGGGGCTGCAGAGAAAAGGG + Intergenic
960023143 3:112978009-112978031 CAATGGTACTGGGGAGCAAAGGG - Intergenic
960027586 3:113026336-113026358 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
960827798 3:121811096-121811118 CATTGGGACTGGTTAGACAATGG + Intronic
961012402 3:123445225-123445247 CAGTGGGGGTGGGGAGAGAAGGG + Intronic
961031053 3:123604344-123604366 AAGTTGGACTGGAGAGACCACGG - Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
961998332 3:131269559-131269581 CATTGGGACTGGTTAGACAATGG - Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962181139 3:133207313-133207335 CACTGGGACTGGTTAGAAAGTGG - Intronic
962482623 3:135810840-135810862 CACTGAGACAGGAGAGCAAAAGG + Intergenic
962875112 3:139530031-139530053 CAGTGGGAATGAAGAAAAACAGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962957577 3:140280250-140280272 CAGGGGTACGGGAGAGAACATGG - Intronic
962982218 3:140500768-140500790 CAGGGAGACTGAGGAGAAAATGG + Intronic
963460928 3:145614158-145614180 TAGTGAGACTGTAGAGAAATAGG - Intergenic
963723492 3:148892110-148892132 CAGTGGGAGAGTAGAAAAAAAGG - Intronic
964093752 3:152907337-152907359 TAGTGAGGCTGCAGAGAAAATGG + Intergenic
964886763 3:161492438-161492460 CAGTGGGACAGGGAGGAAAAGGG - Intergenic
965172830 3:165290163-165290185 CTGTGAGATTGTAGAGAAAAAGG - Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966323209 3:178724118-178724140 TGGTGAGGCTGGAGAGAAAAGGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966726082 3:183109888-183109910 CAGTGAGGCTGTAGAGAAAAGGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967026016 3:185564614-185564636 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
967226169 3:187293455-187293477 TAGAGAAACTGGAGAGAAAATGG - Intergenic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967873825 3:194252832-194252854 AACTGGGAATGGAGAGAAACCGG + Intergenic
968639020 4:1701073-1701095 CTGTGGTACTGGAGAGAATGAGG - Intronic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970186987 4:13466552-13466574 CAGTGAGAATATAGAGAAAAGGG + Intronic
970269846 4:14334373-14334395 CAGTGAGGTTGCAGAGAAAAAGG + Intergenic
970336842 4:15055795-15055817 CACTGAGGCTGGAGAGAACAAGG - Intronic
970423745 4:15928184-15928206 CAGAGGGAGGGAAGAGAAAAAGG + Intergenic
970680822 4:18505928-18505950 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
970718529 4:18957782-18957804 TAGTGGGCCTGGAAGGAAAATGG - Intergenic
970780783 4:19734978-19735000 CATCGGGACTGGAGAGGAAAAGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
970851782 4:20612431-20612453 CAGTGGGACTGGGATGAAAGTGG - Intronic
971021765 4:22544208-22544230 TGGTGGGAGTGGAGAGGAAATGG + Intergenic
971052517 4:22877362-22877384 CAGTGGGACTGGCAAGAGTAGGG - Intergenic
971434985 4:26611081-26611103 CAGGGAGGCTGTAGAGAAAAGGG - Intronic
972130557 4:35827907-35827929 CAATGGGACTGGAAAGAGAAAGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972330333 4:38058158-38058180 CAGTGGGACTGGAGCTTGAATGG + Intronic
972683828 4:41332532-41332554 GAGTGGGACTTGGAAGAAAAGGG + Intergenic
972847990 4:43013031-43013053 TAGTGAGGCTGCAGAGAAAAGGG + Intronic
973633247 4:52838896-52838918 AATTGGGACTGGAGATCAAAGGG + Intergenic
974277812 4:59748677-59748699 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974785424 4:66613670-66613692 TGGTGAGACTGTAGAGAAAAAGG - Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975307515 4:72866612-72866634 CACTGGGACTGGTGAGACAGTGG + Intergenic
975351144 4:73348700-73348722 TGGTGAGACTGCAGAGAAAAGGG + Intergenic
975814283 4:78201827-78201849 CAGTGTGAGTTGGGAGAAAAGGG + Intronic
975884259 4:78945461-78945483 CAGTGAGACTGTGGAGAAATGGG - Intergenic
976116215 4:81730391-81730413 CAGTGAGGTTGTAGAGAAAAAGG + Intronic
976903607 4:90208834-90208856 CAGTGGGACTGGTTAGAAACTGG - Intronic
977314686 4:95431035-95431057 CATAGGGGCTAGAGAGAAAATGG - Intronic
977845809 4:101765234-101765256 CAGTGAGGTTGCAGAGAAAAGGG - Intronic
978203386 4:106049588-106049610 CAGTGGGACAGGGGAGAACCAGG + Intronic
979019410 4:115477232-115477254 TAGTGAGATTGCAGAGAAAAGGG + Intergenic
979023039 4:115526940-115526962 CATTGGGACTGGTTAGACAATGG + Intergenic
979054210 4:115976179-115976201 CGGGGGGAATGGAGAGATAATGG + Intergenic
979091249 4:116485217-116485239 TGGTGAGACTGCAGAGAAAAGGG - Intergenic
979174478 4:117646068-117646090 TAGTGAGGCTGAAGAGAAAAGGG - Intergenic
979934006 4:126669855-126669877 CATTGGGACTGGTCAGAAAGTGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980072591 4:128259685-128259707 GAAGGGGATTGGAGAGAAAAGGG + Intergenic
980888231 4:138786069-138786091 CACTGGGACTGGTTAGACAAAGG - Intergenic
981027182 4:140088461-140088483 CAGTGGGAATGGAAAGGAAGAGG - Intronic
981113744 4:140965750-140965772 GTGGGGGAGTGGAGAGAAAATGG + Intronic
981249539 4:142583337-142583359 AAGTGGGGCAGGAAAGAAAAGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982691624 4:158553761-158553783 AAGTGGAACAGGAGAAAAAAGGG + Intronic
983362346 4:166743595-166743617 CATTGGGACTGGTCAGAAAATGG + Intronic
983711109 4:170716607-170716629 CAGAGGAACTGGTGAGAAAAGGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984770175 4:183430579-183430601 CTGTGGGACAGCAGAGAGAAGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985088528 4:186340287-186340309 GAGTGAGACTGGAGAGGAAGAGG + Intergenic
985512289 5:319481-319503 CAGTGGGACTGTGCAGAAAAAGG - Intronic
985843322 5:2325879-2325901 CGCTGGAACTGGAGAGGAAAGGG - Intergenic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
988218392 5:28307580-28307602 TGGTGAGACTGCAGAGAAAAGGG + Intergenic
988349108 5:30077526-30077548 TGGTGAGACTGCAGAGAAAAAGG + Intergenic
988380140 5:30488711-30488733 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
988479558 5:31618652-31618674 CAGAGGCTCGGGAGAGAAAAAGG + Intergenic
988714489 5:33811598-33811620 CAAGGAGACTAGAGAGAAAATGG + Intronic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989435794 5:41411500-41411522 CTGTGAGATTGGAGAGCAAAAGG - Intronic
989825252 5:45847611-45847633 CACTGGGACTGGTTAGACAATGG + Intergenic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990231282 5:53715818-53715840 CAGTGGGACTGGATAGGCAGTGG + Intergenic
990742093 5:58922673-58922695 CGGTGGGGCTGGGGAGGAAATGG - Intergenic
991513208 5:67403420-67403442 CAGTGAGAATGGAGAAAAAGGGG - Intergenic
992900936 5:81294628-81294650 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995518678 5:112978462-112978484 CACAGGCACTGGAAAGAAAAAGG - Intronic
995696849 5:114888356-114888378 CAGTGAGGCTGTAGAAAAAAAGG + Intergenic
995738590 5:115330063-115330085 TGGTGAGACTGCAGAGAAAAGGG + Intergenic
995808470 5:116080011-116080033 CATTGGGACTGGATAGACAGTGG + Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996910972 5:128656303-128656325 CATTGGGACTGGTTAGACAATGG - Intronic
997660472 5:135585457-135585479 GAGTGGCACTGGAGACAACAAGG - Intergenic
997734741 5:136204964-136204986 CAGTTTCACTGAAGAGAAAAGGG - Intergenic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998924876 5:147111938-147111960 CAGTGGGCTTCGACAGAAAAAGG + Intergenic
998925359 5:147117848-147117870 CAGTGAGAATGCAGAGAAATGGG - Intergenic
998972882 5:147611515-147611537 CATTGGGACTGGTTAGACAATGG - Intronic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999598860 5:153237803-153237825 CTCTGGGGCTGGAGAGAAAGGGG - Intergenic
999602502 5:153282664-153282686 CATTGGGACTGGTTAGACAATGG + Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
999940141 5:156533245-156533267 CAGTTTGAGTGGAGAAAAAATGG - Intronic
999951862 5:156659772-156659794 CCTTGGGAATGGGGAGAAAAAGG - Intronic
999994383 5:157078171-157078193 CAGTGAGACTGAAAAAAAAAAGG - Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000179500 5:158794250-158794272 CAGTGGCACTGGAGGGACAGAGG + Intronic
1000942829 5:167383430-167383452 CTGTGGGACTTGAGAAAACATGG - Intronic
1001544619 5:172563381-172563403 CCATGGAACTGGAAAGAAAAGGG + Intergenic
1001792014 5:174466010-174466032 CACTGGGACTGGTTAGACAATGG + Intergenic
1001937257 5:175714337-175714359 CAGTTCCACTGGAGAGAGAAGGG - Intergenic
1001937482 5:175715589-175715611 CAGGGGAACTGGAGAGAGCAGGG + Intergenic
1001939902 5:175733042-175733064 CAGCGGGACTGGACAGAAAAGGG + Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002453198 5:179331276-179331298 AAGGGAGAATGGAGAGAAAAGGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003002694 6:2350803-2350825 CGGTGAGGCTGCAGAGAAAAGGG - Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004291450 6:14371042-14371064 CAGTGTGACTGGTGAAAATAGGG + Intergenic
1005088657 6:22033514-22033536 TAGTGAGGCTGCAGAGAAAAAGG - Intergenic
1005114608 6:22321795-22321817 AAGAGGTACTGGACAGAAAATGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005825299 6:29628369-29628391 GAGTGGGACGGGAGAGAAACGGG + Intronic
1006388999 6:33747708-33747730 GAGTGGGACTGGGGAGAGATGGG + Intergenic
1006898961 6:37487816-37487838 CAGTGGAACTGCAGATAAATTGG - Intronic
1006922608 6:37636570-37636592 CAGTGGGACTCCTGAGAACACGG - Exonic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1007854454 6:44840299-44840321 CAATTGGACTGGAGAGACAGAGG - Intronic
1007922678 6:45625011-45625033 CAGTGGCGCTGAGGAGAAAATGG - Intronic
1009435452 6:63613083-63613105 TGGTGGGAATGGAGAGATAAGGG + Intergenic
1009628613 6:66166615-66166637 CATTGGGACTGGTCAGAAAGTGG + Intergenic
1010143009 6:72633064-72633086 TGGTGAGACTGCAGAGAAAAGGG - Intronic
1010591615 6:77719003-77719025 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1010629355 6:78178934-78178956 CAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1011575019 6:88787792-88787814 CAGTGACAATGGAGAAAAAAGGG + Intronic
1011746085 6:90409157-90409179 CAGTGGGACTGCCATGAAAAAGG - Intergenic
1012289108 6:97429200-97429222 AAGTGGGAGTGTAGAGAAGACGG + Intergenic
1012335686 6:98053616-98053638 CAGTAGGAGTGGAGAGAGAGTGG + Intergenic
1012401014 6:98843086-98843108 CAGGAAGACTGGAGAGGAAAGGG + Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1012674675 6:102100565-102100587 CAGTGGGACTGGTTAGACAGTGG + Intergenic
1012770639 6:103429220-103429242 TAGTGGGGCTTCAGAGAAAAGGG + Intergenic
1012908265 6:105092014-105092036 CAGGGGCACGGGAGAGAAAGAGG + Intergenic
1013433082 6:110073360-110073382 TGGTGAGACTGCAGAGAAAAGGG + Intergenic
1013471098 6:110466632-110466654 TAGTGAGACTGTGGAGAAAAGGG + Intronic
1013573881 6:111459775-111459797 CAGTGGGGCTGTGGAGAAAAGGG + Intronic
1013816211 6:114101557-114101579 TAGTGAGGCTGCAGAGAAAAGGG + Intronic
1013929642 6:115515948-115515970 CACTGGGACTGGATAGAAAGTGG + Intergenic
1014715458 6:124859954-124859976 CAGTATGACTGGAGAGAATGTGG - Intergenic
1015564166 6:134549538-134549560 CAATGGGATTTGAGAGCAAAGGG + Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016712691 6:147191812-147191834 CAGGGGGACTGGGGTGAACATGG + Intergenic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1018130717 6:160730250-160730272 CAGTGGGACTCAAGATATAAAGG - Intronic
1018274574 6:162117161-162117183 AAGTGGGAAGGGAGAGAAAGTGG + Intronic
1018362317 6:163084433-163084455 TAGAGGAACTGAAGAGAAAATGG + Intronic
1018414375 6:163588717-163588739 CAGTGTGACCGTAGAGAATAAGG - Intergenic
1018606369 6:165602058-165602080 CAGTGGGACAGGGAAGAAAAGGG - Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1019976289 7:4584492-4584514 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1019977225 7:4592996-4593018 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1020409597 7:7876280-7876302 CAGTGGGATTGAAGAGGAATAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1022623288 7:32007215-32007237 CAGTGGTACTGAACAGAAAATGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022765719 7:33408841-33408863 TTGTGAGACTGCAGAGAAAAGGG - Intronic
1023745436 7:43318747-43318769 CAGGGTGTCAGGAGAGAAAAGGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1024973849 7:55095212-55095234 CAGTCGGACAGCAGAGAAGAGGG - Intronic
1025088725 7:56044788-56044810 CAGTGAGACTGGAAAAAAAAAGG + Intronic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026102752 7:67396336-67396358 AAGTGAGACTGGAAAGAACAAGG - Intergenic
1027195347 7:76026257-76026279 CAGCGGGAATGGGGAGGAAAGGG + Intronic
1028013644 7:85679839-85679861 CACTGGGACTGGTCAGAAAGTGG - Intergenic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028659177 7:93248818-93248840 CAGTGGGACTAAAAAGAACACGG + Intronic
1028692106 7:93664050-93664072 CACTGGGACTGGTCAGAAAGTGG - Intronic
1029314799 7:99701581-99701603 CAGTGAGAATGTGGAGAAAAGGG - Intronic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029801195 7:102949222-102949244 TAGTGGGGCAGGAGAGACAATGG + Intronic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030500905 7:110357113-110357135 CATTGGGACTGGTTAGACAATGG - Intergenic
1031003433 7:116444611-116444633 TAGTGGGAATTGAGAGGAAAAGG - Intronic
1031115846 7:117667571-117667593 CATGGGGAGAGGAGAGAAAAAGG - Exonic
1031476989 7:122235513-122235535 TGGTGAGACTGTAGAGAAAAGGG + Intergenic
1031868994 7:127071992-127072014 CAAAGGGAATGGAGAGAAACTGG - Intronic
1031982560 7:128137025-128137047 CAGTGTAACTGGGGAGAAAGGGG - Intergenic
1032261890 7:130345027-130345049 CAGTAGCAATGGAGATAAAAGGG - Exonic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033647153 7:143314433-143314455 TAGTGAGAATGCAGAGAAAAGGG - Intergenic
1034215570 7:149403116-149403138 CAGTGCGACTGGAAACAACATGG + Intergenic
1034220279 7:149439078-149439100 CCCTGAGATTGGAGAGAAAAGGG - Intronic
1034440870 7:151085621-151085643 CAATGGGACTGCAGAGGAACTGG + Intergenic
1034721052 7:153293198-153293220 CATTGGGCATTGAGAGAAAAAGG - Intergenic
1037270184 8:17118551-17118573 CTGGGGGACTGGGGAGGAAAGGG - Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037712051 8:21362551-21362573 AAGTGGGAGTGAAGAGCAAAGGG + Intergenic
1037805361 8:22055585-22055607 CCATGGAACTGCAGAGAAAAAGG - Intronic
1037950382 8:23015623-23015645 CAGTGGAACTGGGGACAGAAGGG - Exonic
1038232115 8:25710982-25711004 AAGTGGAACTGGGGGGAAAAGGG - Intergenic
1038311587 8:26449584-26449606 GACTGGGTGTGGAGAGAAAACGG + Intronic
1038706940 8:29903078-29903100 CACTGGGACAGCAGAGGAAAAGG + Intergenic
1038772197 8:30493380-30493402 CAGTGAGACAGGAGAGGAAAAGG + Intronic
1039254541 8:35704769-35704791 CAGGGGGAATGGGGAGAACAGGG + Intronic
1039516634 8:38139236-38139258 CACTGGAAGTGGGGAGAAAATGG - Exonic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1040063448 8:43124530-43124552 AAGGAGGACTGGAGAGACAATGG + Intergenic
1040443727 8:47472115-47472137 CAGGGAGACTGTATAGAAAATGG - Intronic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1041503500 8:58566907-58566929 GATTTGGAATGGAGAGAAAAAGG - Intronic
1042099138 8:65255418-65255440 CTGTGGGACTGGAGAAAAAGAGG - Intergenic
1042633086 8:70842844-70842866 TATTGGAGCTGGAGAGAAAAAGG - Intergenic
1043605187 8:81991113-81991135 CATTGGGACTGATCAGAAAATGG - Intergenic
1043970561 8:86524021-86524043 TAATGTGAATGGAGAGAAAATGG + Intronic
1044003177 8:86910385-86910407 CTGTAACACTGGAGAGAAAAAGG + Intronic
1044459731 8:92429856-92429878 CAGTAGGAGTTTAGAGAAAATGG - Intergenic
1044483256 8:92718082-92718104 CTGTGGCAGTGGAGAGATAATGG - Intergenic
1044823774 8:96177521-96177543 CTGTGTCACTAGAGAGAAAAAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045883288 8:107065512-107065534 CATTGGGACTGGTGGGACAATGG - Intergenic
1046173184 8:110539929-110539951 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1046236728 8:111433891-111433913 TAGTGAGATTGCAGAGAAAAAGG - Intergenic
1046277719 8:111985398-111985420 CACTGGGACTGGTTAGACAATGG + Intergenic
1046803510 8:118454794-118454816 CAGAGGGAATGGGGAGACAAGGG - Intronic
1047027885 8:120844523-120844545 GAGTGGGACAGGAGAGAGAGAGG - Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047133593 8:122051181-122051203 CATTGGGACTGGTTAGACAATGG + Intergenic
1047219036 8:122903835-122903857 CAGTAGGACTGGAAAGAGAGGGG + Intronic
1047917338 8:129596069-129596091 CAGTGGGTCAGTAGATAAAAGGG - Intergenic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048324329 8:133427489-133427511 CAATGAAGCTGGAGAGAAAAGGG + Intergenic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1050228795 9:3493790-3493812 CAGATGGACTGGAAAGGAAATGG - Intronic
1050522602 9:6517316-6517338 AAGTAGGACTGAAGAGGAAAGGG - Intergenic
1050885252 9:10756513-10756535 CAGTGAGGCTGTGGAGAAAAGGG + Intergenic
1051186219 9:14464062-14464084 CGGTAGGGCTGGAGAGAAAGTGG - Intergenic
1051375311 9:16396535-16396557 CATTGGGATTGCAGTGAAAATGG + Intergenic
1051533999 9:18136552-18136574 CTATGGCACAGGAGAGAAAAGGG + Intergenic
1051801877 9:20944006-20944028 CACTGGGTCAGAAGAGAAAATGG - Intronic
1052025664 9:23570879-23570901 AAATGGGACTGGATAGATAATGG - Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052752654 9:32508409-32508431 CACTGGGACTGGATAGACAGTGG + Intronic
1053140554 9:35680098-35680120 CAGCTGGACTGGAGAGAAAAAGG - Exonic
1053792493 9:41696781-41696803 CAGAGGGTCTAGAGAGAAAGTGG - Intergenic
1053813303 9:41877464-41877486 AAGTGGGACTGGATTAAAAAGGG + Intergenic
1054617292 9:67309975-67309997 AAGTGGGACTGGATTAAAAAGGG - Intergenic
1054821565 9:69526577-69526599 CAGTGAGGCTGTGGAGAAAAGGG + Intronic
1055157176 9:73078751-73078773 CAGAGGTACTTGACAGAAAATGG + Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055745171 9:79436291-79436313 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1056198838 9:84255053-84255075 CAGTTGAGCTGCAGAGAAAATGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058062016 9:100507487-100507509 TTGTGGGACTGCAAAGAAAAGGG - Intronic
1058091685 9:100813014-100813036 AAGTGAGAATGGAGAGAAAGGGG + Intergenic
1058218970 9:102272066-102272088 CTGTGAGACTGTGGAGAAAAGGG - Intergenic
1058277225 9:103059513-103059535 TAGTGAGAATGCAGAGAAAAAGG - Intergenic
1058471585 9:105284931-105284953 AAGTGGGAGTTGAGAGGAAATGG - Intronic
1058557814 9:106188569-106188591 TAGTGAGGCTGCAGAGAAAAGGG - Intergenic
1059000875 9:110347691-110347713 CAGTGAGACAGGAAAAAAAAGGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059299537 9:113300946-113300968 CAGTGGCAGAGGAGATAAAAGGG + Intronic
1059778575 9:117502115-117502137 TGGTGGGGCTGCAGAGAAAAAGG - Intergenic
1059784008 9:117560867-117560889 TAGTGAGACTGCAGAGAAGAGGG + Intergenic
1060282101 9:122221599-122221621 CAATGGGAGTGGGGAGTAAAGGG - Intronic
1060314118 9:122492632-122492654 CGGTGAGGCTGCAGAGAAAAGGG - Intergenic
1060846822 9:126843839-126843861 CAGTGGGATTGATCAGAAAAGGG + Intergenic
1060857195 9:126924268-126924290 CAGTGTGACTGTATAGGAAAAGG + Intronic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061235588 9:129341143-129341165 CTGTGGGACTGGAGAGCCCAGGG - Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061414902 9:130442337-130442359 AAGTGGAAGTGGAGAGAAAGGGG + Intergenic
1062202426 9:135310629-135310651 AAGTGTTACTGGAGATAAAAAGG + Intergenic
1185611132 X:1394311-1394333 CAGGGAGACAGGAAAGAAAAAGG - Intergenic
1185872445 X:3675159-3675181 CAGAGAGCCTGAAGAGAAAAAGG - Intronic
1185973398 X:4690672-4690694 CAGTGAGAGTGAAGAGGAAATGG + Intergenic
1186102781 X:6174284-6174306 CAGTGAGTTTGCAGAGAAAAAGG + Intronic
1186835609 X:13434425-13434447 CATTGAAACTGGAGAGGAAAGGG + Intergenic
1187184955 X:16975349-16975371 CAGTGAGGTTGCAGAGAAAAAGG - Intronic
1187274245 X:17804569-17804591 CAGTAGGACTGGTGAGGACAAGG + Intronic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187733171 X:22277502-22277524 CAGGGGGAACGGAGAGAGAAGGG - Intergenic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1188429139 X:30085773-30085795 CAGTGAGGCTGCAGAGAGAAGGG + Intergenic
1188893780 X:35642367-35642389 CAGTGGGAAGAAAGAGAAAATGG + Intergenic
1188970788 X:36613095-36613117 CAATGAGACTGGATAGAAGAGGG + Intergenic
1189700517 X:43713903-43713925 CACAGGGACAGGAGAGAGAAAGG + Intronic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190448220 X:50552431-50552453 TGGTGGGGCTGGAGAGAAACAGG + Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1190897658 X:54637007-54637029 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1190959861 X:55235156-55235178 CATTGGGACTGGTTAGACAATGG - Intronic
1191115326 X:56846547-56846569 CAGTGGGACTGGTTAGGAAGTGG + Intergenic
1191194337 X:57705491-57705513 CATTGGGACTGGTGAGACAGTGG + Intergenic
1191726979 X:64291963-64291985 CTGTGGGCCTGAATAGAAAAAGG + Intronic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1193316111 X:80066565-80066587 CATTGGGACTGGTCAGAAAGTGG - Intergenic
1193344828 X:80393377-80393399 CAATGGGAGGGGAGAGAAACGGG - Intronic
1193499314 X:82254610-82254632 CAGTGAGGTTGCAGAGAAAAGGG - Intergenic
1194029697 X:88796861-88796883 CAGTGAAATTGCAGAGAAAAGGG + Intergenic
1194233433 X:91352196-91352218 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1194261635 X:91702873-91702895 CATTGGGACTGGTTAGAAAGTGG + Intergenic
1194359690 X:92934416-92934438 TGGTGAGACTGCAGAGAAAAGGG + Intergenic
1194429401 X:93782421-93782443 CAGTGTGACTGGAGCATAAAGGG + Intergenic
1194470744 X:94292551-94292573 TAATGGGACTGGAAAGAAGAGGG - Intergenic
1194598518 X:95889908-95889930 CTGTGGCACTGGAAAGAGAATGG + Intergenic
1194847864 X:98833964-98833986 TAGTGAGGCTGCAGAGAAAAAGG - Intergenic
1195058797 X:101174102-101174124 TAGTGAGACTGCGGAGAAAAGGG + Intergenic
1195569836 X:106385730-106385752 CTGTGGGCCTGAATAGAAAAAGG - Intergenic
1195781484 X:108470274-108470296 TGGTGAGACTGCAGAGAAAAGGG - Intronic
1195910881 X:109887399-109887421 CAGTGTCAAGGGAGAGAAAAAGG - Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196265628 X:113641904-113641926 CGGTGAGGCTGCAGAGAAAAGGG - Intergenic
1196642628 X:118080618-118080640 CAGTGAGGCTGCAGAGAAAAGGG + Intronic
1197066644 X:122240780-122240802 TGGTGGGGCTGGGGAGAAAAGGG - Intergenic
1197579121 X:128259855-128259877 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198008614 X:132526117-132526139 AAATGGGACTGGAAACAAAATGG - Intergenic
1198577998 X:138031973-138031995 TGGTGGGGCTGCAGAGAAAAGGG + Intergenic
1198578004 X:138032012-138032034 TGGTGGGGCTGCAGAGAAAAGGG + Intergenic
1199125220 X:144110458-144110480 TGGTGAGACTGTAGAGAAAAGGG + Intergenic
1199372720 X:147070046-147070068 CAGAGAGACTGGAGAGGAAGGGG + Intergenic
1199924484 X:152448581-152448603 CAGTGGGACTGGGTGGAAAGGGG - Intronic
1199940802 X:152625860-152625882 CAGTGTGACTAGAAAGTAAAGGG + Intergenic
1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG + Intronic
1200381006 X:155837283-155837305 TAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1200580283 Y:4941666-4941688 CATTGGGACTGGTTAGAAAGTGG + Intergenic
1200667888 Y:6050241-6050263 TGGTGAGACTGCAGAGAAAAGGG + Intergenic
1201371560 Y:13269877-13269899 CACTGGGACTGGTTAGAAAGGGG - Intronic
1202370231 Y:24191255-24191277 CAGTGGTGCTGCAGAGAAATTGG + Intergenic
1202500553 Y:25478862-25478884 CAGTGGTGCTGCAGAGAAATTGG - Intergenic