ID: 1047097222

View in Genome Browser
Species Human (GRCh38)
Location 8:121639160-121639182
Sequence TAGAATAAAGAGAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 983
Summary {0: 1, 1: 0, 2: 8, 3: 80, 4: 894}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047097222_1047097227 20 Left 1047097222 8:121639160-121639182 CCAACTTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 8
3: 80
4: 894
Right 1047097227 8:121639203-121639225 ATATACTCAGGCCTCCAGTTGGG No data
1047097222_1047097228 21 Left 1047097222 8:121639160-121639182 CCAACTTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 8
3: 80
4: 894
Right 1047097228 8:121639204-121639226 TATACTCAGGCCTCCAGTTGGGG No data
1047097222_1047097229 22 Left 1047097222 8:121639160-121639182 CCAACTTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 8
3: 80
4: 894
Right 1047097229 8:121639205-121639227 ATACTCAGGCCTCCAGTTGGGGG No data
1047097222_1047097226 19 Left 1047097222 8:121639160-121639182 CCAACTTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 8
3: 80
4: 894
Right 1047097226 8:121639202-121639224 TATATACTCAGGCCTCCAGTTGG No data
1047097222_1047097224 -8 Left 1047097222 8:121639160-121639182 CCAACTTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 8
3: 80
4: 894
Right 1047097224 8:121639175-121639197 TTATTCTAACACTGAGCTGATGG No data
1047097222_1047097225 8 Left 1047097222 8:121639160-121639182 CCAACTTCCTTCTCTTTATTCTA 0: 1
1: 0
2: 8
3: 80
4: 894
Right 1047097225 8:121639191-121639213 CTGATGGTCTATATATACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047097222 Original CRISPR TAGAATAAAGAGAAGGAAGT TGG (reversed) Intronic
901584034 1:10271908-10271930 TGGAATTAAGAGATGGCAGTGGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
902920458 1:19663595-19663617 TAGTATAAAGAGAACGGGGTGGG - Intergenic
903489533 1:23717704-23717726 TAGACTACAGTGGAGGAAGTGGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903609176 1:24597502-24597524 AAAAAGAAAGAGAAGGAAGGGGG + Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904649012 1:31990225-31990247 AAGAAAAAAGAGAAGGATCTGGG - Intergenic
904834584 1:33326981-33327003 TAAAATAAAAAGGAGGAAGCAGG + Intronic
905235512 1:36543462-36543484 GAGAATGAGAAGAAGGAAGTGGG - Intergenic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906258333 1:44367551-44367573 AAAAATTAAGAGAAGGAAATAGG + Intergenic
906285799 1:44587071-44587093 TAAAAAAAACAGAAGGAACTGGG - Intronic
906444448 1:45882703-45882725 TAGACTCAAGCTAAGGAAGTAGG + Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906721772 1:48011358-48011380 GAGAAGAAAGAGGAAGAAGTGGG - Intergenic
906917376 1:50025340-50025362 AAAAATAAAGAGAAAGATGTGGG + Intergenic
906936178 1:50215749-50215771 TCGAAGAAAGAGGAGAAAGTAGG - Intergenic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
907990082 1:59572337-59572359 AAGAATAAGCAGAAGGAAATTGG + Intronic
908360776 1:63367235-63367257 TAGAAGAAAGTGAAGCAGGTTGG + Intergenic
908374041 1:63515413-63515435 TTGAAAAAAAAGAATGAAGTTGG - Intronic
908623370 1:66010917-66010939 TGGAAGAAAGTCAAGGAAGTGGG + Intronic
908664427 1:66474212-66474234 TAGAAAAAAGAGATAGAAATTGG - Intergenic
909087861 1:71188897-71188919 TAGAAGGAAGAGAAAGAAATGGG - Intergenic
909227217 1:73041320-73041342 TAGAATAACTACAAAGAAGTTGG + Intergenic
909431616 1:75593878-75593900 TACAAAAAATAGAGGGAAGTGGG + Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909714288 1:78689155-78689177 TAGAATGAAAAGAAAGAAGAAGG - Intergenic
910556869 1:88544059-88544081 TAGAAGAAAGACAAGTAAATAGG - Intergenic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911042460 1:93601743-93601765 TTGAATAAAGAAAAAGAAGAAGG + Intronic
911557198 1:99359513-99359535 TATAGTAAAGAGAAGGAATCAGG + Intergenic
911624893 1:100112361-100112383 TACAATAAATAGAAGGAAGATGG + Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912732222 1:112117917-112117939 AAGAATGAAGAGATGAAAGTGGG + Intergenic
912852451 1:113138732-113138754 TTAAATGAAGAGAATGAAGTAGG + Intergenic
912875598 1:113355420-113355442 TTGAACAAAAAGAAGTAAGTAGG - Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
913714510 1:121519858-121519880 TCGAATCAAGAAAAGGGAGTAGG - Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916239278 1:162622998-162623020 AAGAATAAAAAGAACCAAGTGGG - Intergenic
916267331 1:162903891-162903913 CAGAAGAAAGTGAAGGAACTGGG + Intergenic
916421179 1:164639226-164639248 ATGATTAAAGAGTAGGAAGTTGG + Intronic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
917504703 1:175617072-175617094 TAGAAGAAAGAGGAGAAAGAAGG - Intronic
917579621 1:176362070-176362092 AAGAATAAAGAGAATGGAGGAGG + Intergenic
917687778 1:177435005-177435027 TAAAATGAGGAGAAGGAATTAGG - Intergenic
917751707 1:178059251-178059273 TAAAATAAAGAAAAATAAGTAGG + Intergenic
919018141 1:192067675-192067697 TTTAACAAAAAGAAGGAAGTAGG - Intergenic
919109898 1:193205806-193205828 AAGAAAAAAGTGAAGGAAATAGG + Intronic
920425113 1:205868867-205868889 TAGAATTAAGAGAAGGAAAAGGG - Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920618257 1:207516708-207516730 CAGAATAAAGATAATGAAATAGG - Intronic
920881660 1:209886561-209886583 AAGAAAAAAGAGAAGGGAATAGG + Intergenic
921025645 1:211278886-211278908 TACAATAAAAAGAAGGGAATTGG + Intronic
921164145 1:212494056-212494078 TAGGCTAAACAGAAGGGAGTGGG - Intergenic
921332988 1:214058532-214058554 TAGTATGAAGAAAAGGAACTTGG + Intergenic
921436201 1:215125888-215125910 TTTAAGAAAGAGAAGGAAATGGG + Intronic
921516650 1:216100657-216100679 GAGAATAAAAACAAGGAATTGGG + Intronic
922854193 1:228760208-228760230 GAAGATAAAGGGAAGGAAGTAGG + Intergenic
922922928 1:229322986-229323008 TAGAATGAAAAGAAAGAATTAGG + Exonic
924062075 1:240185201-240185223 TAAAAGAAAGAGAAGGAAAAAGG - Intronic
924427497 1:243966257-243966279 TAAAATAAGGAAAATGAAGTAGG - Intergenic
924836666 1:247655352-247655374 AAATATAAAGAGAAGTAAGTAGG - Intergenic
1063084062 10:2798936-2798958 TAAAATAAAAAGAATGAAATAGG - Intergenic
1063391740 10:5654055-5654077 TAGAAACAAGACAAGGATGTTGG - Intronic
1063650704 10:7934178-7934200 TAAAAAAAAGTGAAGTAAGTTGG - Intronic
1064414821 10:15139982-15140004 TAGAGAGAAGAGAAGGAACTGGG + Intronic
1065199184 10:23297454-23297476 TAGAATTAAGAGAAGGAAAAAGG - Intronic
1065798122 10:29325743-29325765 TTGAATAAAGAAAAGGAAAGAGG + Intergenic
1066057163 10:31692681-31692703 TAGAAGAAAGAGAGGGATGGGGG + Intergenic
1066395990 10:35022208-35022230 AACAATAAAGAGAAGGAAACAGG + Intronic
1067208193 10:44237479-44237501 AAGAAGACAGAGGAGGAAGTGGG + Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1068236690 10:54244167-54244189 TAGAATAAAGAGTATGATATTGG - Intronic
1068361579 10:55980581-55980603 AAGAATAAAGAAACTGAAGTCGG + Intergenic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1068960321 10:62860869-62860891 TAGAACCAACAAAAGGAAGTTGG - Intronic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069342348 10:67426457-67426479 TAGAAGAAAGAGTAGAAAGTTGG + Intronic
1069477003 10:68743536-68743558 AAGAAAAAAGAAAAGAAAGTAGG - Intronic
1069770561 10:70896630-70896652 AAGAAAAAAGAAAAGGAAGAGGG - Intergenic
1069811083 10:71160258-71160280 TAGACTAAAGAGCATGAAGAAGG - Intergenic
1069971406 10:72173254-72173276 AAGAATAAAGAGAAAGAAAAAGG - Intronic
1070153394 10:73818951-73818973 TAGATAAAAGACAAGGCAGTAGG - Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071699621 10:87916203-87916225 GGGAGGAAAGAGAAGGAAGTGGG + Intronic
1072543590 10:96417033-96417055 TAAACTAGAGAGAATGAAGTTGG + Intronic
1072764826 10:98086877-98086899 AAGAACAAAGAGAAGTCAGTGGG + Intergenic
1073004700 10:100314422-100314444 GAGAAGAGAGAGAAGGAAGCAGG + Intronic
1073219671 10:101860207-101860229 GGGAAGAAAGAGAATGAAGTAGG + Intronic
1073375112 10:103027148-103027170 CACAATAAATTGAAGGAAGTTGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073740982 10:106406572-106406594 TAAAAGAAAGAGAAGGATGGAGG + Intergenic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074496972 10:113987815-113987837 TAAAATGAAGAGTAGGAAATGGG - Intergenic
1074652350 10:115538202-115538224 TAGCATAAATACCAGGAAGTAGG + Intronic
1075166663 10:120074079-120074101 GAGAATATAGGGAAGGAAGGTGG - Intergenic
1075502691 10:122990592-122990614 TTGAATAAAGAGAAGAAACTAGG + Intronic
1076416064 10:130289892-130289914 TACATTAAGGAGAAGAAAGTAGG + Intergenic
1076467921 10:130697734-130697756 TAGAATGAAGAGCAGAAGGTGGG + Intergenic
1077760538 11:5091411-5091433 TAGAATCAGAAAAAGGAAGTAGG - Intergenic
1077820448 11:5733095-5733117 AAGAATAAATATAAGTAAGTTGG - Intronic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1077996699 11:7458752-7458774 GAGAAAAAAGAGAGAGAAGTAGG + Intronic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1078093873 11:8284510-8284532 TAGATTCTAGAGAAGGAAGGAGG + Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078193240 11:9110921-9110943 AAGAATCAAGACAAGGAAGTTGG + Intronic
1078444744 11:11395693-11395715 AAGAAAAGAGAGAAGGAAGGAGG + Intronic
1079139404 11:17798020-17798042 TGTAAGAAAGAGAAGGAAGGTGG + Intronic
1079415304 11:20229372-20229394 TAGTATAAATAGAAGCAACTGGG + Intergenic
1079661396 11:23041321-23041343 TAGAATGAGGATGAGGAAGTGGG - Intergenic
1079740775 11:24057163-24057185 AAGAATAAAGAAAATGAGGTAGG + Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1079943512 11:26712187-26712209 CATAAGAAAGAGAGGGAAGTAGG + Intronic
1080577305 11:33611586-33611608 TAGAAAAAAAAGAAAAAAGTTGG + Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080841911 11:35991631-35991653 TAGAAAATAGAAAAGGGAGTGGG + Intronic
1080956319 11:37099879-37099901 GAGAAAAAAGGGAAGGAAGTAGG - Intergenic
1081215356 11:40389883-40389905 TAGGATAAGTAGAAAGAAGTAGG + Intronic
1081856863 11:46309497-46309519 TAGAATCTAGACAAAGAAGTTGG - Intronic
1082212914 11:49527047-49527069 TAGAATAAAGAGATATCAGTAGG + Intergenic
1082714782 11:56598931-56598953 TAGAATAAAGTGAAGAAAATGGG - Intergenic
1082995121 11:59247940-59247962 TACAAGAAACAGAAGGAAGTGGG + Intergenic
1083133462 11:60648650-60648672 AAGACTAAAGGGGAGGAAGTTGG + Intergenic
1084430987 11:69111088-69111110 TAGACTACAAAGAGGGAAGTAGG - Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084584338 11:70048584-70048606 TAGAAAAGAGAGAGGGAGGTGGG - Intergenic
1085132869 11:74056878-74056900 TACAATAAAGAGAAATAAGAAGG - Intronic
1085499014 11:77000850-77000872 TTGAAAAAAAAGAATGAAGTGGG - Intronic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086547913 11:88019697-88019719 TAACATAAAGAGACTGAAGTAGG - Intergenic
1086636687 11:89097465-89097487 TAGAATAAAGAGATATCAGTAGG - Intergenic
1086775671 11:90829920-90829942 TAAAATAAAAACAATGAAGTAGG - Intergenic
1086797342 11:91123546-91123568 TAGAGCAAAAAGAAGAAAGTTGG - Intergenic
1087264125 11:96042415-96042437 GAGAAAAAAGAGAAGGCAGCTGG - Intronic
1087589108 11:100162124-100162146 GAGAACAAAGAGCAGGGAGTAGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088190926 11:107227369-107227391 TAGAAATAAAAGAAGGAAGAGGG - Intergenic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1088704814 11:112452474-112452496 AAGAATGGAGAGAAGGATGTAGG - Intergenic
1089194366 11:116685098-116685120 TAGAATAAGGAGAAGACAGTTGG + Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1091642466 12:2247807-2247829 GAGAATAAAGAGAAAGGAGCAGG - Intronic
1091725096 12:2840839-2840861 TAGAAAAAAGAGAAAAAAGCAGG + Intronic
1091997764 12:5008401-5008423 TATTATAAAAAGAAGGAAATAGG + Intergenic
1092055036 12:5501716-5501738 TAGACTAAAGAGAAGACAATAGG + Intronic
1092288187 12:7142091-7142113 AAGAACAAAGAGAAGGAAAAGGG + Exonic
1092857137 12:12684782-12684804 AAGAAAATAGAGAAGGAAGGAGG - Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1092989454 12:13881110-13881132 TAGAACAAAGAGGATGGAGTAGG - Intronic
1093039821 12:14365348-14365370 TAGAAAAGAAAGAAGGAAGGAGG - Intergenic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093482802 12:19622681-19622703 AAGAAGAAAAAGAAAGAAGTGGG - Intronic
1093613948 12:21197695-21197717 TGGATTAAGGAGAAGGAAGTCGG + Intronic
1093788774 12:23222316-23222338 TGGAAGAAAGAGAATGCAGTGGG - Intergenic
1094035719 12:26068357-26068379 TAGAAGAAAAAGAAGGAAAAGGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094229096 12:28082438-28082460 CAGGAAAAAGAAAAGGAAGTAGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1095232519 12:39757868-39757890 TACAATAAAGAGAAGGATTGAGG + Exonic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095782237 12:46072677-46072699 TAAAATAAAGAATAAGAAGTGGG + Intergenic
1095901247 12:47330616-47330638 TTGAAAAAATAGAATGAAGTGGG - Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1096733058 12:53630042-53630064 TCGAAAAAAGAGAACGAAATTGG - Intergenic
1096782150 12:53997690-53997712 TAGAATAAAGGGAAAAAAGGGGG - Intronic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097691011 12:62734739-62734761 TTCAATAAAGAGCAGGAGGTGGG + Intronic
1098428081 12:70389098-70389120 AAGAATAAAGAGAGGAAAATGGG - Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098558106 12:71841913-71841935 AAGAAAAAAGATTAGGAAGTAGG - Intronic
1098698249 12:73587208-73587230 TAGAAGAAAGAGCAGCAAGTAGG + Intergenic
1098745453 12:74232130-74232152 TAGAAGAAAGAGGAGGAAAGTGG - Intergenic
1099048464 12:77753650-77753672 TAGAAAAAGGAGGGGGAAGTAGG + Intergenic
1099177433 12:79438091-79438113 TGGAATAGAAATAAGGAAGTAGG - Intronic
1099959205 12:89380472-89380494 TAGAAGGGAGAGAAGGAAGCAGG - Intergenic
1100257955 12:92903299-92903321 TAGAAAAATGAGAATGCAGTCGG + Intronic
1100416631 12:94384732-94384754 GAGAATAAAGAGAAGAAAATTGG - Intronic
1100631294 12:96391991-96392013 TTGAATAAAGTGATGGAATTAGG - Intronic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1100882097 12:99030390-99030412 GAGGATAAAGGGAAGGCAGTGGG - Intronic
1100991356 12:100254708-100254730 AAGAAGAAAGAGAGGGAAGGAGG - Intronic
1101553942 12:105789164-105789186 TGGAAAAAAACGAAGGAAGTTGG + Intergenic
1101757326 12:107631087-107631109 TAGGAGAGAGAGAAGGAAGGAGG - Intronic
1101886443 12:108667478-108667500 TAAAATAAAAAAGAGGAAGTAGG - Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102391976 12:112556675-112556697 AAGAAGGAAGAGGAGGAAGTGGG + Intergenic
1103643028 12:122368030-122368052 GAGAGTAAAGAGAACGAATTGGG - Intronic
1103739624 12:123082368-123082390 AAGAAGAAAGAAAAGTAAGTCGG - Intronic
1104151606 12:126089632-126089654 TAAAAGAAAGAGAAAGAAGAGGG + Intergenic
1104499838 12:129274503-129274525 TAAAAAAAAGATGAGGAAGTAGG - Intronic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105052372 12:133066114-133066136 GAAAGGAAAGAGAAGGAAGTAGG + Intergenic
1105272422 13:18890897-18890919 TAGACTAATGAGAAGGCAATGGG - Intergenic
1105359133 13:19690792-19690814 AAGAGGAAAGAGAAGAAAGTTGG - Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106052411 13:26204011-26204033 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1106064973 13:26337590-26337612 TAAAACAAATAGAAGGAACTGGG + Exonic
1106105470 13:26729140-26729162 TAGAATAAAGAAGAGGAAATGGG + Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1106374242 13:29169291-29169313 TAGAATAAAAAGAAGCACATTGG + Intronic
1106587438 13:31069666-31069688 TAGCTGAAAGAGAAGGAACTGGG + Intergenic
1107247674 13:38316842-38316864 TAGAATAGACAATAGGAAGTAGG + Intergenic
1107838582 13:44433104-44433126 TAGGATCAAAAGACGGAAGTTGG - Intronic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109007460 13:56897143-56897165 TATAAATAAGAGAAGGAAGATGG + Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109068523 13:57733288-57733310 TAAAATAAAATGATGGAAGTAGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110610792 13:77485685-77485707 TTTAATAAAAAGAGGGAAGTGGG + Intergenic
1110812345 13:79824757-79824779 TATAAAAAAGTGAAAGAAGTAGG - Intergenic
1111278731 13:85989711-85989733 AAGAATAAAGAAAATGAACTTGG - Intergenic
1111338623 13:86854762-86854784 TTGAATAAAAATAACGAAGTGGG + Intergenic
1111507204 13:89207858-89207880 TAGAATAATGGAAAGGAAATTGG + Intergenic
1111676370 13:91394443-91394465 CACAATAAAGAGAACCAAGTTGG - Intergenic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112446772 13:99471644-99471666 TAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1112798978 13:103089476-103089498 AAAAAAAAAGAGAAGGAAATAGG + Intergenic
1112856561 13:103777448-103777470 TGGAATAATGCGAATGAAGTTGG - Intergenic
1113063621 13:106352122-106352144 TAGAAAAAAGAGAGAGAAATAGG - Intergenic
1113238235 13:108306022-108306044 AAGAAGAAAGAGGAGGAAATGGG - Intronic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114860192 14:26508372-26508394 TTGAAGAAAGAAAAGGAACTGGG + Intronic
1114881905 14:26796717-26796739 AAGAAGAAAGAGAAAGAAGGAGG + Intergenic
1114882734 14:26806873-26806895 AAGAATAAAGAGGAGAAAGCAGG - Intergenic
1115057051 14:29141286-29141308 TCTAATAAAGAGAAAGAGGTGGG + Intergenic
1115167527 14:30465604-30465626 TAGGATATGGAGAATGAAGTTGG - Intergenic
1115398307 14:32933568-32933590 CGGAAGAAAGAGGAGGAAGTGGG + Intergenic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1115913562 14:38283791-38283813 TAGAATAAAGACAAGGTCATAGG + Intergenic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1116470954 14:45285077-45285099 TGGAAGAAAGAAAAGGAAGCTGG - Intergenic
1116759167 14:48989621-48989643 TAGAATAATGATAAGTAAATAGG + Intergenic
1117325427 14:54664575-54664597 CAGGAGGAAGAGAAGGAAGTGGG - Intronic
1117664192 14:58039265-58039287 AAGGATAAAGAGAAGGGAATAGG - Intronic
1117740059 14:58808626-58808648 TAGAATTAAGAGAAGAAAGTAGG + Intergenic
1118453397 14:65924525-65924547 TAAAAAAAAAAAAAGGAAGTAGG - Intergenic
1118505067 14:66402327-66402349 AGGAATTAAGAGAAGGAAGGTGG - Intergenic
1118898847 14:69969926-69969948 TGGAGAAAAGAGAAGAAAGTGGG + Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119616463 14:76102051-76102073 TGGAAGGAAGAGACGGAAGTTGG - Intergenic
1119873872 14:78040088-78040110 TTGAAAAAGGAGAACGAAGTTGG - Intergenic
1119954925 14:78787478-78787500 TAGAATAAAGCAAAGGTAATAGG + Intronic
1120077756 14:80179455-80179477 AAAAATAAAGAAAAGGAAGAGGG + Intergenic
1120241405 14:81953624-81953646 TAGTGTAGAGAGAAGGAAGCAGG - Intergenic
1120390483 14:83901153-83901175 AAGAATAAAGGGAAGAAATTTGG + Intergenic
1120424195 14:84326889-84326911 TGGAATTAAGATAAGGTAGTTGG - Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120490954 14:85177861-85177883 AATAATAAAGGGAAGGGAGTAGG + Intergenic
1121888046 14:97562576-97562598 TAGAAGGAAGAGATGGAAGAAGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122496349 14:102158637-102158659 AAGAATAAGGATAGGGAAGTAGG - Intronic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1122674758 14:103402581-103402603 TACATTAAATAGAAGGCAGTTGG + Intronic
1124037440 15:26068774-26068796 GAAAATAAAAAGAAGGAAGGAGG - Intergenic
1124192273 15:27590756-27590778 TAGCATGAAGGGAAGGAAGGAGG - Intergenic
1124568614 15:30838954-30838976 TAGAATGAAGAGACTCAAGTAGG - Intergenic
1124828646 15:33126230-33126252 TAGACTTCAGAGAAGGAAGATGG + Intronic
1124956178 15:34362047-34362069 TAGAATAAATAAAAGGAAGTGGG - Intronic
1125786746 15:42325348-42325370 TAGAATAGAGATGAGGAAGGAGG + Intronic
1125799760 15:42435072-42435094 TAGAATAAAGAGAAAAATGTAGG - Intronic
1125911742 15:43446018-43446040 TAGAATAAAGAGAAGATACAAGG - Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1126937799 15:53730631-53730653 TAGGAAGAAGAGAAGGAAGTCGG - Intronic
1126938507 15:53739177-53739199 GAGAATGAAGTGAAGAAAGTAGG + Intronic
1127019142 15:54726594-54726616 GATAACACAGAGAAGGAAGTTGG - Intergenic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1127566124 15:60190152-60190174 TAGGAAAAAGAGAAGCATGTTGG + Intergenic
1127566713 15:60196546-60196568 AGGAATAAAGGGAAGGAAGGAGG + Intergenic
1127988124 15:64090882-64090904 TAAAATAAGCAGAAGGGAGTGGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1129013563 15:72445225-72445247 TAAAAAAAATAGAAGGAAATAGG - Intergenic
1129288919 15:74548333-74548355 TAGAATAGAAAGAAGAAAGATGG + Intronic
1130937059 15:88479553-88479575 AGGACTAAAGAGAAGGCAGTAGG - Exonic
1131694586 15:94862387-94862409 TAAAATAAAAATAAGGAAGAGGG - Intergenic
1131973729 15:97919656-97919678 TGGAATAACCAGAATGAAGTGGG + Intergenic
1133433136 16:5755922-5755944 CATAATGAAGAGAGGGAAGTAGG + Intergenic
1133510954 16:6456887-6456909 TAGAAAAAAGAGAAAGTATTGGG + Intronic
1133656295 16:7867830-7867852 TAAAATGAAGAGAAAGGAGTAGG + Intergenic
1133954831 16:10433170-10433192 AGGAAAAAAGAGAAGGAAATAGG - Intronic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135292015 16:21248002-21248024 AAGAAGAAAGAAAAGGATGTTGG - Intronic
1137376367 16:47955461-47955483 TAAAACAAGGAGAAGGAAATTGG - Intergenic
1137496883 16:48976604-48976626 AAGAATAAAAAGAAGAAATTGGG - Intergenic
1138058332 16:53860057-53860079 TTGAATAAAGAAAATGCAGTAGG + Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138541598 16:57691039-57691061 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139108965 16:63864994-63865016 GAGAAGAAAAAGAAGAAAGTTGG + Intergenic
1139229188 16:65266365-65266387 TAAGATAAAGAAAAGGAACTTGG - Intergenic
1139411832 16:66768420-66768442 GATTATAAAAAGAAGGAAGTAGG + Intronic
1139501043 16:67366130-67366152 AAAAAAAGAGAGAAGGAAGTGGG - Intronic
1139742012 16:69043557-69043579 GTGAATAAAGAAAAGGAAATGGG + Intronic
1139842100 16:69889915-69889937 TAGAATAAAGAGATGGGATAAGG - Intronic
1140109794 16:71994262-71994284 TTGAGTAGAGAGAGGGAAGTGGG - Intronic
1140139548 16:72242391-72242413 TAGAATAAAGAGAACTAAGGAGG - Intergenic
1140638534 16:76944926-76944948 GAGAAAAAAAGGAAGGAAGTAGG + Intergenic
1141031787 16:80595592-80595614 AAGAACAAAGAGAGTGAAGTGGG - Intergenic
1141039298 16:80658018-80658040 TCCAATAAAGAGAAGAAAGGTGG + Intronic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1141472218 16:84246831-84246853 TGGAATAAACAGGAGGAAGGTGG + Intergenic
1142477454 17:197841-197863 TAGCATAAAGAGAGGGTGGTGGG - Intergenic
1142919817 17:3174889-3174911 TAAAATAAAAAAAAGGAAGGAGG + Intergenic
1143600899 17:7945196-7945218 CATAATTAAAAGAAGGAAGTGGG - Intronic
1143725394 17:8841569-8841591 TGGAATAAAGAAAAGCCAGTTGG - Intronic
1143794586 17:9326416-9326438 TAGAAAACAGGGAAGGAAGCTGG - Intronic
1144166250 17:12613768-12613790 TTGATGGAAGAGAAGGAAGTTGG - Intergenic
1144242734 17:13329289-13329311 AAGAATAAAGGGAAGGCAGGAGG + Intergenic
1144437695 17:15256101-15256123 TAGAAAAACGAGAAGGCAGGCGG + Intronic
1145262359 17:21361964-21361986 AAGAAGAAAGAGGAGGGAGTAGG - Intergenic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1148545756 17:48517705-48517727 AAGGATAAAAAGAGGGAAGTGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148924375 17:51070446-51070468 TAGAATATATTTAAGGAAGTAGG - Intronic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149295409 17:55257603-55257625 CACAATAAAGGGAGGGAAGTTGG + Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150075973 17:62192346-62192368 TAGAATAAAAAGAAAGCAGGAGG - Intergenic
1150174732 17:63040255-63040277 TAAAATAAAGGAGAGGAAGTAGG + Intronic
1150993090 17:70283546-70283568 TAGAATAGAGAGAAGGTTGTAGG + Intergenic
1151179129 17:72313030-72313052 GAGTAGAAAAAGAAGGAAGTTGG - Intergenic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151522977 17:74643921-74643943 TAGAAGAGAGAGAAGGAAGGTGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1154111685 18:11574586-11574608 AAGAAGAAAGAAAAGGAAGGAGG + Intergenic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155796497 18:30044362-30044384 AGGAAGAGAGAGAAGGAAGTTGG + Intergenic
1156598848 18:38579837-38579859 TAGAAGGAAGAGGAAGAAGTAGG + Intergenic
1156850712 18:41722675-41722697 AAGAATTAAGAGAAGCAAATGGG + Intergenic
1156859747 18:41822063-41822085 TCTAAGACAGAGAAGGAAGTAGG - Intergenic
1158021068 18:52842449-52842471 TAGAACAAAAAGAAGTAAGAAGG - Intronic
1158194302 18:54867085-54867107 TAAAGGAAAGAGCAGGAAGTGGG + Intronic
1158734257 18:60061936-60061958 TAGAATATAGAGAAGGATCCTGG + Intergenic
1159140985 18:64394342-64394364 TACACTAAAGAGAAGAAAGTTGG + Intergenic
1159736874 18:72111012-72111034 TAGAAGAAAGTGAAGGAGGGAGG + Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159855069 18:73576978-73577000 TAGAATAAAGATATAGTAGTTGG - Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1162205704 19:9054705-9054727 CAGAAGAGAGAGAAGGAACTGGG - Intergenic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1163751525 19:19081136-19081158 AAGAATAAAGAAAAGAAAGGAGG + Intronic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1163924622 19:20328289-20328311 GAGAATAAAGAGAAGGCTCTGGG - Intergenic
1164131622 19:22368326-22368348 CAAATGAAAGAGAAGGAAGTAGG + Intergenic
1164173877 19:22750830-22750852 TAGAATTAAGAAAAGGAAAAAGG + Intergenic
1164230814 19:23286584-23286606 TAGAAAAAAAAAAAGGAAGAAGG + Intergenic
1164919955 19:32082056-32082078 CAGCATGAAGAGAAGGGAGTGGG + Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165183799 19:33998734-33998756 TAGAAGAGAGAGAAAGAAATAGG + Intergenic
1165247636 19:34506323-34506345 AAGAATAAACAGAAAGAAATCGG + Exonic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166278630 19:41774404-41774426 AAGTGTAATGAGAAGGAAGTAGG + Intergenic
1166450711 19:42898160-42898182 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166462611 19:43002502-43002524 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166692723 19:44833467-44833489 AAGAAGAAAGAAAAGGAAGGAGG + Intergenic
1167051306 19:47080384-47080406 TAGAGAAAATAGAGGGAAGTTGG - Intronic
1167155684 19:47737240-47737262 AAAAAAAAAGAAAAGGAAGTTGG + Intronic
1167507242 19:49877380-49877402 TACAATATGGAGAAGGAAGTGGG + Exonic
925003194 2:422545-422567 TAGAATATAAACAAGGAAGCTGG + Intergenic
925812345 2:7712809-7712831 AAGAAGAAAGAGAATGAATTAGG - Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926883935 2:17579421-17579443 TAGACTATATAGAAAGAAGTGGG - Intronic
927061843 2:19430417-19430439 CAGTATACAGGGAAGGAAGTTGG + Intergenic
927314383 2:21665074-21665096 TAGAATAGAAAAAAAGAAGTGGG - Intergenic
928422172 2:31146442-31146464 TAGGAAAAAGAAAAGGAATTAGG - Intronic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
929095946 2:38263425-38263447 CAGAAGCAAGAGAAGGACGTGGG + Intergenic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
929308200 2:40390394-40390416 TAGAATAATTAGCAGGAAGCAGG - Intronic
929375691 2:41284077-41284099 TAGAATAAACTGAAGTAAATAGG + Intergenic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
930093790 2:47551357-47551379 AAGAATAAAGTGATGGAAGTAGG - Intronic
930239581 2:48922031-48922053 TAGTATAAATAGAAGAAAGTTGG - Intergenic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
931082105 2:58785220-58785242 AAGGAGAAAGAGAGGGAAGTTGG + Intergenic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
931982438 2:67708447-67708469 TATTGTAAAGTGAAGGAAGTAGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932028640 2:68160404-68160426 AAGTATAAAGAGAAAGGAGTAGG - Intronic
932068510 2:68591904-68591926 TGGAAGAAAGGGAAGGAAGTAGG + Intronic
932094061 2:68831381-68831403 GAGAACAGAGAGAAGGAAGGAGG - Intergenic
932516206 2:72352533-72352555 TAGATTAAAGAGAAAGAAAGAGG + Intronic
932842216 2:75094288-75094310 TAAAATAAAGAGAAGTAAGTAGG + Intronic
932880391 2:75495856-75495878 GAGAAGAAAAAGAAGTAAGTGGG - Intronic
932888347 2:75568185-75568207 AAGATTAAAGAGAAGGAAAGAGG - Intronic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
934046494 2:88176995-88177017 TACAAAAAAGACAAGGGAGTAGG - Intronic
934551251 2:95263614-95263636 AATAATTAAGAGAAGAAAGTTGG - Intergenic
934870077 2:97855795-97855817 GATAATAAAGAGAATGAAATAGG - Intronic
935070175 2:99687140-99687162 CAGAACAAAGAGAAGGATCTAGG + Intronic
935938633 2:108214857-108214879 TAAAATAAAGAAATGAAAGTGGG + Intergenic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
936495186 2:113014268-113014290 TAGCATCAAGAGAAGAAAATGGG - Intergenic
936784425 2:116076761-116076783 AAGATGAAAAAGAAGGAAGTAGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937159829 2:119749750-119749772 TAGAATTAAGTGAAGGAATTTGG - Intergenic
937629990 2:124090680-124090702 TAAAAAAAGAAGAAGGAAGTAGG + Intronic
938003207 2:127763420-127763442 TAGAAAATAGAGAAGGAACATGG - Intronic
938195436 2:129323419-129323441 TAGAACAAAAAGGAGGAAGAAGG - Intergenic
938246853 2:129783778-129783800 AAAAATAAAGATAAGAAAGTGGG + Intergenic
938776912 2:134550032-134550054 TGATATAAAGAGATGGAAGTTGG + Intronic
938888415 2:135677960-135677982 AAAAACAAAGAGAAGGAAGGAGG - Intronic
939222369 2:139318929-139318951 TAGAATAAAGAGATGGGTGGGGG - Intergenic
939252660 2:139702495-139702517 TAGAATAAAGAAAGGCAAGTTGG - Intergenic
939472385 2:142640115-142640137 TAGAAAGAAAAGAAGGAAGAAGG - Intergenic
940165460 2:150765446-150765468 TAGATAAAAGAGAGGAAAGTGGG + Intergenic
940277087 2:151950797-151950819 GAGTAGAAAGAGAAGGGAGTGGG + Intronic
940364117 2:152827211-152827233 TTGAAGAAAGAAAATGAAGTAGG + Intergenic
940437106 2:153668602-153668624 TAGGATGAAGGGAAGGAAGCTGG + Intergenic
940529651 2:154864923-154864945 TAGAATAAAGACAAAGAGGGAGG - Intergenic
940531420 2:154882615-154882637 GAGTATAAAGAGAAGGAAAGGGG - Intergenic
940737959 2:157474453-157474475 TGCAATAAAGATAAGAAAGTTGG + Intronic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941378805 2:164765391-164765413 AGGAACAAAGAGAAGGGAGTGGG + Intronic
941477753 2:165969280-165969302 ATGAATAAAGAGAAGAAATTTGG + Intergenic
941499318 2:166249828-166249850 TAGGATAACTAGAAAGAAGTTGG - Intronic
942062639 2:172241767-172241789 TAGAATATAGAGGAGGCAGCTGG - Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942629227 2:177938089-177938111 TAGGATAAAAGGAAGGATGTAGG + Intronic
942652485 2:178183284-178183306 TAGAATACAGAGAGGAAATTGGG - Intergenic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
942862094 2:180627121-180627143 TAAGATAAAGAGAAGCAAGGTGG - Intergenic
943025286 2:182620515-182620537 TAGAATAAAGAGTAAGAACAAGG + Intergenic
943284080 2:185974669-185974691 TAGAATAAAATGATGGAAGAAGG + Intergenic
943804745 2:192110543-192110565 TAGAAGAAATAGAAAGAATTGGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944247589 2:197547187-197547209 GAGGAGAAAGAGAAAGAAGTGGG + Intronic
944979215 2:205094905-205094927 TAGAAAAAACTTAAGGAAGTTGG - Intronic
945141942 2:206696200-206696222 TAGAAAGAAGAGAAGGAATAAGG + Intronic
945453359 2:210018964-210018986 TAGAACAAAGAGGGAGAAGTGGG - Intronic
945673677 2:212831748-212831770 TAAAACAAAGAGAAGGCCGTGGG + Intergenic
945681703 2:212921642-212921664 TAGAACAGAGAGTAGTAAGTAGG - Intergenic
945880846 2:215323245-215323267 TTGAATAAAAAAAACGAAGTTGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946038769 2:216766062-216766084 AAGAAAAAAGAAAGGGAAGTGGG + Intergenic
946059436 2:216929074-216929096 TAAAAAAAAGAGAAGAAAATTGG - Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
947321101 2:228919820-228919842 AGGAAGAAAGAGAGGGAAGTGGG - Intronic
947351675 2:229252870-229252892 TAGAGAAAAGACAAGGAGGTGGG + Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
948127475 2:235575163-235575185 GAGAATAAAGAGATGGTGGTTGG + Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1169089316 20:2848462-2848484 TAGATTCAAGAGGTGGAAGTGGG - Intronic
1169385698 20:5147568-5147590 AAAAATAAAAAGAAAGAAGTGGG - Intronic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1169770836 20:9198363-9198385 TAGAAGAAAGAGAAGAAGGTAGG + Intronic
1169830600 20:9820965-9820987 AAGAATAAAGAGAAGAAATTTGG - Intronic
1170132847 20:13041436-13041458 TACAATAAAAAGAACCAAGTGGG - Intronic
1170472738 20:16684483-16684505 TAAAATAAAAAGAGGGAATTTGG + Intergenic
1170749664 20:19134270-19134292 TAAACTCAAGAGAAGGCAGTGGG + Intergenic
1170838506 20:19905090-19905112 TACAATAAAGACCAGAAAGTGGG - Intronic
1173014388 20:39211633-39211655 TAGAATAAGAAGCAGAAAGTGGG + Intergenic
1173713045 20:45176937-45176959 AACATTAATGAGAAGGAAGTGGG - Intergenic
1173828868 20:46065451-46065473 GAGAATCAAGAGAAGGACCTGGG - Intronic
1173930285 20:46811908-46811930 TATACTAAAGAAAAGCAAGTCGG + Intergenic
1174394681 20:50239655-50239677 TAGAATGATGAGAAGGAGCTGGG + Intergenic
1174673603 20:52331880-52331902 TAAAACAAAGTGAAGGAATTGGG + Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175461628 20:59155952-59155974 AAGACTAAAGAGGAAGAAGTAGG + Intergenic
1176810335 21:13529909-13529931 TAGACTAATGAGAAGGCAATGGG + Intergenic
1176984587 21:15421280-15421302 GAGAAAACAGAGAAGCAAGTAGG - Intergenic
1177521857 21:22237043-22237065 TAGAACAGAAAGAAGGAAGAAGG + Intergenic
1178193932 21:30320760-30320782 TTGAATATAGATAATGAAGTTGG + Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1180880001 22:19196929-19196951 TAGAAAAAAAAATAGGAAGTGGG + Intronic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182983772 22:34697812-34697834 TACACTAAAGATAAGGAAATGGG + Intergenic
1183028375 22:35083669-35083691 TAGAATAAAGAACAGAATGTTGG - Intronic
1183032327 22:35115470-35115492 AAGAAAAAAGAAAAGGAAGGTGG + Intergenic
1183104700 22:35607516-35607538 TGGAATAAAGAGAAGGTAGGAGG - Intronic
1183204629 22:36410179-36410201 TAGGCTAATGAGACGGAAGTGGG - Intergenic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
1185305495 22:50113124-50113146 TAGAAGAAGGGGAAGTAAGTGGG + Intronic
949225876 3:1695240-1695262 GAGGAGAAAGAGTAGGAAGTGGG + Intergenic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
949813237 3:8030756-8030778 TGGAAGAAAGAGAAAGAAATTGG + Intergenic
949891503 3:8736984-8737006 AAGAATAAAGAAAAGAAAGAAGG + Intronic
950179647 3:10902132-10902154 TAGAAGAAAGAAAAGGCTGTGGG + Intronic
950516129 3:13466673-13466695 AGGAATAAAGAGAAGGTAATAGG + Intergenic
951044601 3:18024184-18024206 TACAATACACAGAAGGAAATGGG + Intronic
951175640 3:19596083-19596105 GAGAAGAAAGAAAGGGAAGTGGG - Intergenic
951287496 3:20832682-20832704 TTGAAGAAAGAGAAAGAAGTGGG - Intergenic
951417628 3:22444498-22444520 TAGGATAAAGAAAAAGAAGCTGG - Intergenic
952106272 3:30073319-30073341 TAGAATAAAGTGAAGAAAGGTGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952442029 3:33340589-33340611 AAAAAAAAAAAGAAGGAAGTAGG + Intronic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
953037307 3:39224258-39224280 TTGAATAAAGAGCTGGAAGAAGG - Intergenic
953408352 3:42671850-42671872 TAGAATAAAGAGATATAAGAGGG - Intergenic
953421224 3:42754778-42754800 TAGTCCAAAGAGCAGGAAGTGGG + Intronic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
955836597 3:63062258-63062280 TAGTATTCAGAGAAGGAGGTTGG - Intergenic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956205366 3:66749539-66749561 TGGAAAAGAGAGAATGAAGTGGG + Intergenic
956321230 3:67998928-67998950 TAGCATAGAAAGAAAGAAGTAGG - Intergenic
956556013 3:70523799-70523821 TAGTATAAAGACAAGGTAGCAGG + Intergenic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
957842209 3:85686157-85686179 GATATTAAACAGAAGGAAGTAGG - Intronic
957936802 3:86954802-86954824 AAGAATAAAGGAAAGGAAGAAGG + Intronic
958188035 3:90148252-90148274 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
958410555 3:93810077-93810099 TTGAAGATAGGGAAGGAAGTAGG - Intergenic
958586900 3:96098850-96098872 TAGAAAAAACAGACAGAAGTTGG + Intergenic
958773448 3:98453776-98453798 TAAAAGAAAGAGAAGAAAGAGGG - Intergenic
959019396 3:101171802-101171824 TAGAATTCAGACAAGAAAGTTGG - Intergenic
959747474 3:109793837-109793859 TAGATTACAGAGGAGGAAATGGG + Intergenic
959836791 3:110927382-110927404 TTGAAGAAAGAAAAGGAAGGAGG + Intergenic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960811831 3:121633521-121633543 TAAAATAAAAAGAATGAAGATGG - Intronic
961127324 3:124431522-124431544 TAGGAAAAAGAGTAGGAAATGGG + Intronic
962288971 3:134114409-134114431 TAGAAAATAGAAGAGGAAGTGGG + Intronic
962495781 3:135937657-135937679 TAGAATTAAGAGAAGGAAAAAGG + Intergenic
962633199 3:137300779-137300801 TAGAAAACAGAGAAGGAGATGGG + Intergenic
962724548 3:138210450-138210472 AAAAATTAAGAGAAGCAAGTAGG + Intronic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963626036 3:147674463-147674485 TAGATTAGAGAGAAGAAAATTGG - Intergenic
963644098 3:147892355-147892377 AAGAATAAATTGAAGGGAGTAGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
964016930 3:151959145-151959167 TAGAATAAAGAGTAGAAAGGAGG + Intergenic
964564155 3:158031388-158031410 AAGCATAAAGACAGGGAAGTAGG + Intergenic
964577404 3:158188367-158188389 TGTATCAAAGAGAAGGAAGTTGG - Intronic
964590497 3:158358349-158358371 TAGACTAAGGAGATGGCAGTGGG - Intronic
964896390 3:161601851-161601873 TTGAAGAAATAGAAGGATGTTGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
965992252 3:174833035-174833057 TGGAAGAAAGTGAAGGAAGTGGG - Intronic
965996437 3:174888300-174888322 AAGTATAAAGAGAAGTAATTAGG + Intronic
966152047 3:176875817-176875839 GAGAATGAAGAAAAGCAAGTCGG - Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966668367 3:182498427-182498449 TAGAAAGAAGAGAAAGAAGCAGG + Intergenic
966763760 3:183440113-183440135 TAGAATAAAGGTAAAGAACTAGG - Intergenic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
968834464 4:2953126-2953148 TCGACTAAAGAGAATGCAGTAGG + Intronic
969932877 4:10649160-10649182 TAGTTAAAATAGAAGGAAGTAGG - Intronic
970022683 4:11586909-11586931 AAGGATACAGAGAAGGAAGCAGG + Intergenic
970032862 4:11696922-11696944 TACTATAAAGAAAATGAAGTAGG - Intergenic
970065075 4:12084148-12084170 TAGAATTAAGATAGGGAAGAGGG - Intergenic
970510042 4:16772878-16772900 TAATATAAAGTGAAGGAAATAGG + Intronic
970620654 4:17814404-17814426 AAAAAGAAAAAGAAGGAAGTTGG + Intronic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971626008 4:28921035-28921057 TAGAATAAATATAAGAAAGGAGG + Intergenic
971655249 4:29336003-29336025 TAGAAGAAAAAGGAGGAAGGAGG - Intergenic
972098645 4:35382758-35382780 TATAATAAACAGAAGTATGTTGG - Intergenic
972200134 4:36704051-36704073 TAGGAGAAAGAGGATGAAGTTGG + Intergenic
972235890 4:37134178-37134200 TTGAATCAATAAAAGGAAGTTGG - Intergenic
972712540 4:41612127-41612149 TTGCATCAAGAGAAGGGAGTGGG - Intronic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
972866515 4:43239897-43239919 GAGAATAAAGAAGAGGAAGAAGG + Intergenic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973252867 4:48078940-48078962 AAGAAGGAAGAGAAGGAAGAAGG + Intronic
973284036 4:48395227-48395249 TAGAATTAAGAGAAAACAGTGGG + Intronic
973364010 4:49192616-49192638 TAAAAGAAAGAGAGAGAAGTTGG - Intergenic
973397072 4:49604127-49604149 TAAAAGAAAGAGAGAGAAGTTGG + Intergenic
973695477 4:53486379-53486401 TAGAAAAAAGAGAGGGATGCTGG - Intronic
974292090 4:59946147-59946169 TTGAATAAGAAGATGGAAGTAGG - Intergenic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
974521734 4:62989587-62989609 TAGAATAAAAAGTATGATGTTGG + Intergenic
975082327 4:70296245-70296267 TAGAAAAAAGTAAAGGAAGCAGG - Intergenic
975289715 4:72663437-72663459 AAGAAGAGAGGGAAGGAAGTAGG - Intergenic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
975948987 4:79745064-79745086 TAGGAAGAGGAGAAGGAAGTGGG - Intergenic
976133442 4:81909307-81909329 GATACAAAAGAGAAGGAAGTTGG + Intronic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
976535119 4:86204761-86204783 TAGTAAAAAGAAAAGGAATTGGG - Intronic
976942909 4:90728283-90728305 TAGACTAAAGAGAAATAACTAGG - Intronic
977123538 4:93134759-93134781 CAGAACAAAATGAAGGAAGTTGG + Intronic
977582434 4:98740208-98740230 TAGAAGAGTGAGAAGGATGTTGG + Intergenic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977646023 4:99413521-99413543 TGGGATAAAGTGAGGGAAGTAGG - Intronic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978645422 4:110925361-110925383 TATAATAAAGGGAAGAAAATGGG - Intergenic
978680604 4:111377044-111377066 TATAATAGAGAGAGTGAAGTAGG - Intergenic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
978880038 4:113690621-113690643 TGGCAAAAAGATAAGGAAGTTGG - Intronic
979065740 4:116130290-116130312 TAAAATAAAAATAAGAAAGTTGG + Intergenic
979302994 4:119108705-119108727 TAGAATAAATAGAAGACATTAGG + Intergenic
979549846 4:121978295-121978317 TAGAACACAGGAAAGGAAGTGGG + Intergenic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
979670527 4:123356075-123356097 TAGAATACAGAAAAAGAACTAGG + Intergenic
980060882 4:128128073-128128095 TACAAACAAAAGAAGGAAGTTGG + Intronic
980226316 4:129991237-129991259 TATAATTAAGAGAAATAAGTTGG - Intergenic
980239749 4:130158383-130158405 TAGAACAAAAAGATGGAAGAAGG + Intergenic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
980464716 4:133157827-133157849 TAGAAAAAAGAAAAGCAAGAAGG - Intronic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980743971 4:136991402-136991424 CAGAACCAAGAGATGGAAGTAGG - Intergenic
980810479 4:137871871-137871893 TTTAATAAAGACATGGAAGTGGG - Intergenic
980833709 4:138163449-138163471 TGGAATAAGGAGATGGGAGTTGG + Intergenic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981983483 4:150825914-150825936 TATTGTAAAGAAAAGGAAGTTGG + Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983595856 4:169467003-169467025 TAGGCTGAAGAGGAGGAAGTTGG - Intronic
984059116 4:174970167-174970189 TACAATAAAGAGGATGAAGTGGG + Intronic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984118478 4:175712056-175712078 TAGAACAAAAAGATGGAAATTGG + Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984226334 4:177039813-177039835 TCAAATAATGAGGAGGAAGTTGG + Intergenic
984491086 4:180435796-180435818 TACAATAAAGGGATTGAAGTGGG + Intergenic
984606638 4:181793251-181793273 TAGAAGAAAGAAAAGGCAGATGG - Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
984727167 4:183032656-183032678 TAGAAAAAAGAGAAGGCATCAGG + Intergenic
984801451 4:183720942-183720964 ACAAATAAAGAGAAGGAATTAGG - Intergenic
984859402 4:184223496-184223518 TTGAATAAAAAGAATGAAGCTGG + Intergenic
985188576 4:187345914-187345936 TGGAACCAAGAGAAGAAAGTGGG - Intergenic
985341572 4:188960273-188960295 TGGAATAAAAAAAAGGAAGGAGG - Intergenic
986067061 5:4245124-4245146 GAGAAGAAAGAGAAGGAAAACGG - Intergenic
986091374 5:4511847-4511869 TGGAAGAGAGAGAAGGAAGTGGG - Intergenic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
986947780 5:13045884-13045906 TAGAATAATGAAAAGAAAGAAGG - Intergenic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
987733915 5:21813633-21813655 TGGAATGAAGTGAAGGAAGAGGG - Intronic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988181021 5:27793875-27793897 TAGAAAAAAGAAAAGGAGTTAGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988734518 5:34007501-34007523 TAGAAAAAAAAGGAGGAATTTGG + Intronic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
989065061 5:37452062-37452084 CAAAATAAAGAGAATGAAATTGG - Intronic
989120097 5:37996701-37996723 TATAATAAAGGGAAAAAAGTAGG - Intergenic
989505209 5:42218652-42218674 TTGAAAGAAGAAAAGGAAGTTGG + Intergenic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
989963235 5:50440621-50440643 TCGAATCAAGAAAAGGGAGTAGG + Intronic
990206348 5:53433693-53433715 AAGAAAAAAGAGAAAGAAATGGG + Intergenic
990258784 5:53999116-53999138 GAGAATAAAGAGAAGGCTGTAGG + Intronic
990384176 5:55243313-55243335 CAGAATAAAGGGAAAGATGTTGG + Intergenic
990746681 5:58965779-58965801 TGGGAGAAAGTGAAGGAAGTTGG - Intergenic
990800584 5:59598352-59598374 AAAAATAAAAAGCAGGAAGTGGG + Intronic
991329162 5:65473822-65473844 TAGAAGAAAGTGCAGGATGTTGG - Exonic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991991096 5:72340408-72340430 GATAATAAAGATAAGGAAATGGG + Intronic
992127646 5:73658233-73658255 TAGAGTAAAGAGAAGAAATGGGG - Intronic
992327452 5:75674957-75674979 TCAAGTAGAGAGAAGGAAGTTGG - Intronic
992672867 5:79076967-79076989 TAGACAAAAGGGAAGGGAGTGGG + Intronic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
992940662 5:81758133-81758155 TAGAAGGAAGAGAGGGAAGGAGG + Intergenic
992941237 5:81764429-81764451 TGAAAAAAAGCGAAGGAAGTAGG + Intergenic
992959407 5:81943590-81943612 TAGAATAAGGAGAAGAACGTTGG + Intergenic
993019328 5:82572497-82572519 TATAACCAAGACAAGGAAGTGGG - Intergenic
993080841 5:83298334-83298356 TAGGATAAACAGAGGGAAATGGG - Intronic
993248378 5:85482492-85482514 TAGGATGAAAAGAAAGAAGTGGG + Intergenic
993432727 5:87851924-87851946 AAGAAAAAAGAAAAGAAAGTTGG - Intergenic
993450450 5:88067219-88067241 TTAAACAAAGAGAAGCAAGTGGG + Intergenic
993492861 5:88572968-88572990 TAGAATAGATAGTAGAAAGTGGG - Intergenic
993525294 5:88957959-88957981 GAGAATAAAGAAAAGAAAGCAGG - Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
993967426 5:94374815-94374837 AAGGATTAAGAGGAGGAAGTAGG - Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994827865 5:104739094-104739116 TAAAATACAGAGAAGGAAAAAGG + Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
995062449 5:107825693-107825715 AAGAATGAAGAGAAAGAAATTGG - Intergenic
995260503 5:110098571-110098593 TAGAATATAGAGTTGGATGTTGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
995978282 5:118069733-118069755 CAGAATAATGAGAAGCCAGTAGG - Intergenic
996000956 5:118362960-118362982 TAGAACCAGGAGCAGGAAGTAGG - Intergenic
996038954 5:118789134-118789156 TACCATAAGGAGAAGGATGTGGG + Intergenic
996308764 5:122079241-122079263 TTTGGTAAAGAGAAGGAAGTAGG + Intergenic
996765660 5:127031694-127031716 TAGAATCAAAAGCAGGGAGTTGG + Intergenic
996906862 5:128610713-128610735 AAGGATAAAGGGAAGGGAGTTGG + Intronic
996971356 5:129372202-129372224 TGGAATAAAGAGAAGGGAAATGG + Intergenic
997036605 5:130200459-130200481 TAGAATTAACAGAAGACAGTGGG - Intergenic
998261302 5:140633701-140633723 TAGGTTCAAGAAAAGGAAGTTGG + Exonic
998702717 5:144722499-144722521 TGGAATAAAGCAAAGGAAATGGG - Intergenic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999445429 5:151634964-151634986 AAGAAGGAAGAGAAGGAAGGAGG + Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999616327 5:153428486-153428508 GAAAAGAAAGAGAAGGAAGGAGG + Intergenic
1000388513 5:160699101-160699123 TAGAATAAAGGGAAGAAAATGGG - Intronic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000485823 5:161842471-161842493 TAGAATAAAGATCAAGAATTAGG - Intergenic
1000754660 5:165143211-165143233 TAAAATACTGAGAAGGAATTTGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001016482 5:168146207-168146229 TATAAAAAAGAGTTGGAAGTTGG - Intronic
1001108407 5:168875306-168875328 AAGAAGAAAGAGGAGGAAGGAGG + Intronic
1001129993 5:169055849-169055871 AAAAAGAAAAAGAAGGAAGTTGG + Intronic
1001290495 5:170454664-170454686 AAGAAAAATGAGTAGGAAGTTGG + Intronic
1001383671 5:171320360-171320382 TAGGCTAAGGAGGAGGAAGTGGG - Intergenic
1001492869 5:172168116-172168138 CAGAATAAAGACAGGGAAATAGG - Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002870317 6:1161265-1161287 TAGAAAAAAATGTAGGAAGTTGG - Intergenic
1004007414 6:11649881-11649903 TAGACGAAACAGCAGGAAGTAGG + Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004464374 6:15870606-15870628 TAGAAAACAGAGCAGAAAGTAGG - Intergenic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004785131 6:18960135-18960157 AAGAATAAAGTGCAGGAAGGGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005441997 6:25880094-25880116 TAGATTTAAGAGAAGGGAGAAGG - Intronic
1005976749 6:30805966-30805988 TTGAAGAGAGAGGAGGAAGTGGG - Intergenic
1006137732 6:31906119-31906141 AAGGAGAAAGAGAAAGAAGTTGG - Intronic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1008371642 6:50738950-50738972 TAAGATAAAGAGAAAGCAGTAGG - Intronic
1008424621 6:51342687-51342709 TATAATAAAGAGATGGAAGGAGG + Intergenic
1008499085 6:52162407-52162429 GAGAAGGATGAGAAGGAAGTAGG - Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008995721 6:57656068-57656090 AAAAAGAAAGGGAAGGAAGTTGG - Intergenic
1009291673 6:61890222-61890244 TTGAATAAATAAAAGCAAGTGGG + Intronic
1009700661 6:67174495-67174517 TAAACTGAAGAGATGGAAGTTGG + Intergenic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1010348992 6:74849342-74849364 AAGTTTAAAGAGAAGGATGTAGG - Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011082743 6:83507715-83507737 TATAAGAAAGAGAAGGAGCTGGG + Intergenic
1011094439 6:83644078-83644100 TATACTAAAGAGAAGTAATTTGG - Intronic
1011503901 6:88020261-88020283 GAGAAGAGAGATAAGGAAGTAGG - Intergenic
1011568840 6:88712018-88712040 TAGTCTAAAGAGAAGCAAGCTGG + Intronic
1011722346 6:90170887-90170909 TAGAACCTAGAGAAGTAAGTAGG + Intronic
1011920896 6:92576764-92576786 CAGAATAAAGAAAAGCAAGGTGG + Intergenic
1012051170 6:94345806-94345828 TAAAATAAAGTTAAGGAACTGGG - Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012882998 6:104814117-104814139 AAGAATAAAGAAAAGAAAGGGGG + Intronic
1013012378 6:106132367-106132389 TAAAAGAAAGAGAAGGAACCGGG + Intergenic
1013026996 6:106285103-106285125 GAGAATAGAGAGATGGAAATTGG - Intronic
1013423347 6:109986936-109986958 TAGAATGAAGAAAAGGAAAAGGG + Intergenic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1014030558 6:116697418-116697440 TAGAAAAATGAAAAGGAAGAAGG + Intronic
1014222928 6:118816521-118816543 TAAAATAAAGAAAATGAAATCGG + Intronic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014688276 6:124530894-124530916 TAGAACAAAAAGATGGAAGAAGG - Intronic
1014760732 6:125354048-125354070 AAGAAAGAAGAGTAGGAAGTAGG + Intergenic
1015434547 6:133170875-133170897 TGTCATAAAGAGTAGGAAGTAGG - Intergenic
1015526571 6:134179894-134179916 TAAATTAAAGAGAAGCCAGTGGG + Intronic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016017403 6:139200176-139200198 TAGAAGAGAGGGAAGGAAGGTGG - Intergenic
1016199643 6:141393098-141393120 TAGAAGGAAGAAAAGGAAGAGGG + Intergenic
1016203930 6:141450373-141450395 TAGAATAAGGAGATAAAAGTTGG - Intergenic
1016441369 6:144087537-144087559 TAGAAAAAAGGGAAGGAAATTGG + Intergenic
1016583897 6:145662157-145662179 GAGAGAGAAGAGAAGGAAGTGGG - Intronic
1016659667 6:146563346-146563368 TGGAAGGAGGAGAAGGAAGTAGG + Intergenic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1016961333 6:149675281-149675303 TAGAAGAGAGAGATGGAAGTAGG + Intronic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017934744 6:158995576-158995598 TAAAATAAAGTGAAAGAAGAAGG - Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1020103803 7:5411232-5411254 AAGAAAAAAGAAAAGGAAGGGGG + Intronic
1020383863 7:7576370-7576392 TAGAATATAGACAAGTAAGCTGG + Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1020695692 7:11411257-11411279 TGGAATAAAAACAAGGATGTTGG - Exonic
1021199326 7:17710645-17710667 GGGAAGAAAGAGAAGGAATTGGG - Intergenic
1021342581 7:19482656-19482678 TAAAATAAAGAGAAGCCAGTAGG - Intergenic
1021360176 7:19703301-19703323 TGCAATAAAGAGAAGGAATTGGG + Intronic
1021403727 7:20239651-20239673 TAGAAGGAATAGAAGGAGGTGGG - Intergenic
1021438399 7:20648792-20648814 CAGAAAAAAAATAAGGAAGTAGG - Intronic
1021514205 7:21465136-21465158 TAGAATAAATAGAAATAACTAGG + Intronic
1021565071 7:22008760-22008782 ATCAATAAAAAGAAGGAAGTGGG + Intergenic
1021681983 7:23142240-23142262 TAAAATATAGAGAAGGATGTGGG - Intronic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022901173 7:34811965-34811987 GAGAAGAAAGAGAAGGAAAGAGG - Intronic
1023069060 7:36410246-36410268 TAGAATGAGGAGAGGGCAGTAGG - Intronic
1023641312 7:42261917-42261939 AAGAAGAAAGAAAAGGAAGAAGG - Intergenic
1024141721 7:46468877-46468899 GAGAATACAGAGAGGGAAGGAGG - Intergenic
1024375719 7:48636125-48636147 TACAATAATGAGAAGAAAGCAGG - Intronic
1025729430 7:64096970-64096992 AAGAAAAAAGAAAAAGAAGTGGG - Intronic
1026385152 7:69839526-69839548 TGGAATAAAGGGATGGAAGCTGG + Intronic
1027758221 7:82243776-82243798 TAGAATAAAGAAGAAGAATTTGG - Intronic
1028279239 7:88899679-88899701 TTGAATAAATTGAAGTAAGTTGG - Intronic
1029097762 7:98102687-98102709 TAAAATAAAGAAAAGGAAAATGG - Intergenic
1030172285 7:106615573-106615595 AAGAACAAAGAGAAAGAATTGGG + Intergenic
1030319868 7:108154573-108154595 TTGAAAGAAGAGAAGGAAGTGGG + Intronic
1030503863 7:110395164-110395186 TGGAAGAAAGAGAAGGAGGGAGG + Intergenic
1030739974 7:113097462-113097484 TAGTAAAAAGTCAAGGAAGTTGG + Intergenic
1030814891 7:114023642-114023664 TAGAATATAGAAAAGGAGCTTGG - Intronic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1031233562 7:119142395-119142417 TAAAATAAAGGTAAGGAAGGGGG + Intergenic
1031326437 7:120404805-120404827 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1031592171 7:123606642-123606664 TAGAAAAAAGAGTAGAATGTTGG - Intronic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031754549 7:125621863-125621885 TAGAAGAGACAGAAGAAAGTTGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1032736294 7:134695617-134695639 GAAAAGAAAGAGAAGGAAGAAGG - Intergenic
1032746765 7:134793918-134793940 TAGAGTAAAGTGAAGGAATGAGG - Intronic
1032748791 7:134815013-134815035 GAGAATAAAGGGTAGGAAGCAGG - Intronic
1032910311 7:136420944-136420966 TAGAATATAGAGAAGGTTGTTGG - Intergenic
1033200614 7:139365797-139365819 TATAAGAAGGTGAAGGAAGTTGG + Intronic
1033238832 7:139660188-139660210 TAAAGGAAAGAGTAGGAAGTAGG + Intronic
1033254954 7:139792429-139792451 GAGAATAAAGACAAGTAGGTAGG - Intronic
1033279796 7:139997715-139997737 TAGAGTAAATAGAAGAAACTAGG + Intronic
1034239166 7:149596630-149596652 GAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1034328708 7:150263086-150263108 TAGAGAAAACAGTAGGAAGTCGG + Intronic
1034464069 7:151215445-151215467 TAGAGTAAAGAAAAGGTAGTAGG + Intronic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034764508 7:153706299-153706321 TAGAGAAAACAGTAGGAAGTCGG - Intergenic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035487014 7:159233881-159233903 CAGAATAAAAAGAAGAAAGTTGG - Intergenic
1036236712 8:7045144-7045166 TGGAACAATGGGAAGGAAGTAGG + Intergenic
1036628806 8:10496123-10496145 GAGAAGAAAGAGAAGGAAAAAGG + Intergenic
1037014485 8:13885717-13885739 TGGAATATAGAGAAGGGAGATGG + Intergenic
1037045695 8:14300288-14300310 AAGAATAAAGGGAGGGAAGGAGG + Intronic
1037146885 8:15582881-15582903 AAGAACAAAGAGAAGGTTGTAGG - Intronic
1037360853 8:18072008-18072030 TAAGTTAAAGAGTAGGAAGTTGG - Intronic
1039133100 8:34290115-34290137 TAGCATAAACAGAAGCCAGTGGG - Intergenic
1039779907 8:40774499-40774521 TAGAATAAATTCAAAGAAGTAGG - Intronic
1040702570 8:50085339-50085361 TAGAAGGAAGAGAAGAAAGAAGG - Intronic
1040705231 8:50118046-50118068 TGGAAAATAGAGAAGCAAGTAGG - Intronic
1040727822 8:50404460-50404482 TTGAATAAAAAGAACAAAGTTGG + Intronic
1040752413 8:50727001-50727023 TTGAAAAAAGGGAAGGGAGTGGG + Intronic
1040918122 8:52584849-52584871 TTGAATAAATATAAGGAAGTAGG - Intergenic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041398102 8:57412633-57412655 AGGAATAGAGAGAAGGGAGTAGG + Intergenic
1041409281 8:57535735-57535757 TACTATAAAGAGTAGGAACTTGG + Intergenic
1041538398 8:58954888-58954910 AAGAAAAAAGAGAAGATAGTGGG + Intronic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042068298 8:64902849-64902871 TAGAATAAAAAGGAGAAAGAAGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042341387 8:67683806-67683828 AAGAATAGAAAGAAGGAAATTGG - Intronic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042889348 8:73590069-73590091 AAGAAAGAGGAGAAGGAAGTAGG + Intronic
1042940312 8:74100643-74100665 CAGGAGAAAGATAAGGAAGTGGG - Intergenic
1043636529 8:82391043-82391065 TAAAATAAAGAAAAAGAAGGTGG - Intergenic
1044161923 8:88929621-88929643 TATAATAACGACAAGGATGTTGG + Intergenic
1044422817 8:92017686-92017708 TAGAAAATAGATGAGGAAGTGGG + Intronic
1044532401 8:93322296-93322318 AAAATCAAAGAGAAGGAAGTTGG + Intergenic
1044691976 8:94889923-94889945 TATAATAAAGAGAAGGTATCTGG + Intronic
1044892450 8:96851722-96851744 TAGAATAAAGAAAACGAAAGGGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045316664 8:101049305-101049327 AAAAAGAAAGAGAAGGAAGGAGG - Intergenic
1045909506 8:107390156-107390178 TAGATTAAAAATAAGGAACTAGG - Intronic
1046124306 8:109884944-109884966 CAGAATAAAGATAATGAAGAAGG - Intergenic
1046155856 8:110289356-110289378 TAGAATGAGAGGAAGGAAGTGGG - Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046847949 8:118939645-118939667 ATGAAGAAAGAGAAGGAATTTGG + Intronic
1046966833 8:120176866-120176888 GAGAATAAGGAGGAGAAAGTGGG - Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047326057 8:123836899-123836921 AATAACAAAGAGAAGGAAGCGGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048062260 8:130932475-130932497 TGGGGAAAAGAGAAGGAAGTGGG - Intronic
1048088356 8:131209460-131209482 TAGAATAGAGAGAATGAGATTGG - Intergenic
1048608827 8:135999800-135999822 CAGCAGATAGAGAAGGAAGTAGG - Intergenic
1048750502 8:137668176-137668198 CAGAACAAAGAGAATGAAGTAGG + Intergenic
1049760335 8:144329281-144329303 TGGAATAAAGGGCTGGAAGTGGG + Intergenic
1050298561 9:4232703-4232725 CATAATAAAGATGAGGAAGTTGG + Intronic
1050803642 9:9646617-9646639 TAGTATAAAGAGGAGGAAGAAGG - Intronic
1051000615 9:12278062-12278084 AAGTCAAAAGAGAAGGAAGTGGG + Intergenic
1051017270 9:12494006-12494028 TAGTATAAAGAAAATGAAGAGGG - Intergenic
1051034655 9:12729135-12729157 TTGAAGAAAGAGAAGGCAGCTGG + Intergenic
1051403599 9:16709830-16709852 TGGAATAAATAGAAGAGAGTAGG + Intronic
1051813676 9:21079030-21079052 TAGAAAAAAGAGAAGGCTTTGGG + Intergenic
1052043671 9:23769934-23769956 TAGACTGAAGAGAAGGACTTGGG - Intronic
1053625128 9:39862467-39862489 AAGAAAAAAGAAAAGAAAGTAGG - Intergenic
1053879741 9:42580761-42580783 AAGAAAAAAGAAAAGAAAGTAGG + Intergenic
1054218767 9:62388231-62388253 AAGAAAAAAGAAAAGAAAGTAGG + Intergenic
1054231950 9:62520938-62520960 AAGAAAAAAGAAAAGAAAGTAGG - Intergenic
1054805978 9:69396081-69396103 TAGAATGCAGAGCAGGAAGAGGG + Intergenic
1054892117 9:70261993-70262015 GAGAAGAAAGAGAAGGTAGCTGG + Intronic
1054968209 9:71054156-71054178 CAGATTAAAGATAAGGAACTTGG + Intronic
1055058471 9:72045281-72045303 GAGAAGAGAGAGAAAGAAGTAGG - Intergenic
1055354662 9:75425679-75425701 TAAAACAAAGAGAAGGGATTGGG + Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055810610 9:80143678-80143700 TAGAAAAAAGAGAAGTTGGTCGG + Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1056860185 9:90174158-90174180 GAAAAAAAAAAGAAGGAAGTAGG - Intergenic
1057362361 9:94385415-94385437 TAGAAAAGAGAGAGAGAAGTTGG - Intronic
1057813884 9:98279752-98279774 AAGAAAAAAGGGAAGAAAGTGGG - Intergenic
1057992182 9:99781891-99781913 TAGAATAAGTAAAAGAAAGTTGG + Intergenic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058346624 9:103971396-103971418 TAGAATAAAGACAAAAAAATCGG - Intergenic
1058844469 9:108942975-108942997 TATAACAAAGTGAAAGAAGTTGG + Exonic
1058875874 9:109244400-109244422 GAGAAAGAAGAGAAGGAAGGAGG + Intronic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1059677464 9:116553119-116553141 AAGAAGAAAGAGGAGGAAGGGGG - Intronic
1059811019 9:117855703-117855725 TAGAAGAAAGAGATGGAAGCTGG + Intergenic
1059927276 9:119222605-119222627 TAGAGAAAAGACAAGGAACTAGG + Intronic
1060922599 9:127432709-127432731 AAGAATAAAGATATGGAAGATGG - Intronic
1061017708 9:127991891-127991913 GGGAATTAAAAGAAGGAAGTTGG - Intergenic
1061572889 9:131488561-131488583 AAGAATAAAGAGATGGATGAGGG - Intronic
1061645385 9:131996751-131996773 TAGAGTAAGGAGGAGGAGGTTGG - Intronic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185843637 X:3416772-3416794 TATAATAAAAAGAAGAAAGAAGG - Intergenic
1185870282 X:3658915-3658937 TAGAATGAAGGCAAGGACGTGGG + Intronic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1186056981 X:5660325-5660347 TAGAATAAATAGAATAAAATCGG - Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186330468 X:8526967-8526989 TAAAAGAATGTGAAGGAAGTTGG + Intergenic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186949456 X:14607220-14607242 TTGAAAGAAGAGAAGGAACTTGG + Exonic
1187264589 X:17719162-17719184 AGGAATAATGAGAAGGAAGGAGG + Intronic
1187603359 X:20857987-20858009 TTGAATAGAGAGTAGGAGGTTGG - Intergenic
1187777620 X:22780274-22780296 TGGAATAAAGAAAAGAAAGAGGG + Intergenic
1188185824 X:27113485-27113507 TATAATAAAGATAAGGATATTGG + Intergenic
1188396464 X:29689940-29689962 TAGAATGAATAAGAGGAAGTAGG + Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1189028560 X:37426430-37426452 TAGAGTAAAGAGAAGTAAAGAGG - Intronic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189696133 X:43665047-43665069 GGGAATAAAGAGAAAGAACTAGG + Intronic
1189705688 X:43756553-43756575 TAGAATAAAGATATGAAAGCGGG - Intergenic
1189895154 X:45647787-45647809 TAGGATAAAAACAATGAAGTTGG + Intergenic
1191671713 X:63754678-63754700 TAGAAAGGAGAGGAGGAAGTAGG + Exonic
1191820121 X:65297101-65297123 TTGAATAAAGAGGTGAAAGTGGG - Intergenic
1192143956 X:68668213-68668235 GAGAAAAAAGAGAAAGAAGAAGG - Intronic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1192336389 X:70223867-70223889 TAGAGAAAGGAGTAGGAAGTGGG - Intergenic
1192734865 X:73840943-73840965 TAGAATAAACTTAAGGAAGTGGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1193300148 X:79880064-79880086 AAGAATAAAAATAAAGAAGTAGG + Intergenic
1193436946 X:81485764-81485786 TAGATTAAAGGTAAAGAAGTGGG + Intergenic
1194299913 X:92173352-92173374 TAGAATAAAGAAAATGAAAAAGG + Intronic
1194413650 X:93583798-93583820 GATATCAAAGAGAAGGAAGTTGG + Intergenic
1194530236 X:95038671-95038693 TAGAGTGAAGAAAATGAAGTAGG - Intergenic
1194832542 X:98641925-98641947 TAGAAAAAAAAGAGGGCAGTGGG + Intergenic
1195694795 X:107658949-107658971 GAGAAAGAAAAGAAGGAAGTAGG + Intergenic
1196011684 X:110895015-110895037 TAGCATAAAGGCAAGGAAGGGGG + Intergenic
1196820604 X:119697425-119697447 GAAAAGAAAGAGAAGAAAGTTGG + Intergenic
1197209438 X:123816792-123816814 AAAAAAAAAAAGAAGGAAGTTGG + Intergenic
1197343406 X:125301706-125301728 TAGAATAAAGACATGGAGGTAGG - Intergenic
1197646957 X:129028095-129028117 TTGAATAAAGGGAAGGGAGAGGG - Intergenic
1197686425 X:129444059-129444081 TAGAATCAAAAGAAGGCAGGTGG - Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198326806 X:135582217-135582239 TAGACAAAAGAGAAGAGAGTTGG - Exonic
1198426384 X:136524876-136524898 TAGGATAAAGACAAAGAAGTAGG + Intergenic
1199009561 X:142743124-142743146 TAGATTAAAGACAAGGAGGCTGG - Intergenic
1199218733 X:145292092-145292114 TAGATTAATGAGGAGGGAGTAGG - Intergenic
1200310643 X:155073339-155073361 TAGAAAAAAAAAAAGGAAGTGGG - Intronic
1200713792 Y:6514287-6514309 AATAATAGAGAGAAGGAAATGGG + Intergenic
1201020034 Y:9646872-9646894 AATAATAGAGAGAAGGAAATGGG - Intergenic
1201432756 Y:13921912-13921934 TAAAATAATGTGAAGGAAGTTGG - Intergenic
1201601657 Y:15736143-15736165 TAGAGTAAGGATTAGGAAGTTGG + Intergenic
1201691607 Y:16772656-16772678 TTGAATAAACAGAATGAAATAGG - Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic