ID: 1047099752

View in Genome Browser
Species Human (GRCh38)
Location 8:121663793-121663815
Sequence AAATTGCACCTAAGGTATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047099748_1047099752 25 Left 1047099748 8:121663745-121663767 CCAATTAATTTTGAAATGCTTTC No data
Right 1047099752 8:121663793-121663815 AAATTGCACCTAAGGTATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047099752 Original CRISPR AAATTGCACCTAAGGTATCG TGG Intergenic
No off target data available for this crispr