ID: 1047100155

View in Genome Browser
Species Human (GRCh38)
Location 8:121667522-121667544
Sequence TGCGCAGGAGCCCCCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047100143_1047100155 17 Left 1047100143 8:121667482-121667504 CCGTGGAACGGGGAGCGGCGCTT No data
Right 1047100155 8:121667522-121667544 TGCGCAGGAGCCCCCGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047100155 Original CRISPR TGCGCAGGAGCCCCCGGCGG GGG Intergenic
No off target data available for this crispr