ID: 1047100945

View in Genome Browser
Species Human (GRCh38)
Location 8:121675273-121675295
Sequence CAAATTGTGAGACAGGTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047100942_1047100945 -5 Left 1047100942 8:121675255-121675277 CCTCTGTCTCCTTGTGGGCAAAT No data
Right 1047100945 8:121675273-121675295 CAAATTGTGAGACAGGTACGTGG No data
1047100939_1047100945 23 Left 1047100939 8:121675227-121675249 CCTAGGGATGACTTTGAGTTCTG 0: 5
1: 3
2: 3
3: 12
4: 162
Right 1047100945 8:121675273-121675295 CAAATTGTGAGACAGGTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047100945 Original CRISPR CAAATTGTGAGACAGGTACG TGG Intergenic
No off target data available for this crispr