ID: 1047101331

View in Genome Browser
Species Human (GRCh38)
Location 8:121679409-121679431
Sequence GAGAGCTATCCCTTTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047101331_1047101337 10 Left 1047101331 8:121679409-121679431 CCTGGCCCAAAGGGATAGCTCTC No data
Right 1047101337 8:121679442-121679464 ATTTTAGAAACCTGTAGCAAGGG No data
1047101331_1047101342 29 Left 1047101331 8:121679409-121679431 CCTGGCCCAAAGGGATAGCTCTC No data
Right 1047101342 8:121679461-121679483 AGGGATTAGGAGAATGGGACAGG No data
1047101331_1047101338 16 Left 1047101331 8:121679409-121679431 CCTGGCCCAAAGGGATAGCTCTC No data
Right 1047101338 8:121679448-121679470 GAAACCTGTAGCAAGGGATTAGG No data
1047101331_1047101336 9 Left 1047101331 8:121679409-121679431 CCTGGCCCAAAGGGATAGCTCTC No data
Right 1047101336 8:121679441-121679463 GATTTTAGAAACCTGTAGCAAGG No data
1047101331_1047101341 24 Left 1047101331 8:121679409-121679431 CCTGGCCCAAAGGGATAGCTCTC No data
Right 1047101341 8:121679456-121679478 TAGCAAGGGATTAGGAGAATGGG No data
1047101331_1047101340 23 Left 1047101331 8:121679409-121679431 CCTGGCCCAAAGGGATAGCTCTC No data
Right 1047101340 8:121679455-121679477 GTAGCAAGGGATTAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047101331 Original CRISPR GAGAGCTATCCCTTTGGGCC AGG (reversed) Intergenic
No off target data available for this crispr