ID: 1047104463

View in Genome Browser
Species Human (GRCh38)
Location 8:121718256-121718278
Sequence ATGGAATAACAAAGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047104463_1047104464 -5 Left 1047104463 8:121718256-121718278 CCTGTGTTTCTTTGTTATTCCAT No data
Right 1047104464 8:121718274-121718296 TCCATAATCAATGAAAAGAATGG No data
1047104463_1047104466 10 Left 1047104463 8:121718256-121718278 CCTGTGTTTCTTTGTTATTCCAT No data
Right 1047104466 8:121718289-121718311 AAGAATGGAGACTGCATTTGTGG No data
1047104463_1047104467 23 Left 1047104463 8:121718256-121718278 CCTGTGTTTCTTTGTTATTCCAT No data
Right 1047104467 8:121718302-121718324 GCATTTGTGGTCTGAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047104463 Original CRISPR ATGGAATAACAAAGAAACAC AGG (reversed) Intergenic
No off target data available for this crispr