ID: 1047109170

View in Genome Browser
Species Human (GRCh38)
Location 8:121769412-121769434
Sequence TTAGTTTTGTTTCCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047109165_1047109170 14 Left 1047109165 8:121769375-121769397 CCAACATTTTGGTCAACATGAAC No data
Right 1047109170 8:121769412-121769434 TTAGTTTTGTTTCCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047109170 Original CRISPR TTAGTTTTGTTTCCCAGGAG AGG Intergenic
No off target data available for this crispr