ID: 1047113032

View in Genome Browser
Species Human (GRCh38)
Location 8:121811994-121812016
Sequence TACCACCACTAAGCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047113032_1047113036 25 Left 1047113032 8:121811994-121812016 CCTGCTCTGGCTTAGTGGTGGTA No data
Right 1047113036 8:121812042-121812064 TGGTCACTTTTCCCATTTTCAGG No data
1047113032_1047113034 5 Left 1047113032 8:121811994-121812016 CCTGCTCTGGCTTAGTGGTGGTA No data
Right 1047113034 8:121812022-121812044 TATTTCAAGTTAAATTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047113032 Original CRISPR TACCACCACTAAGCCAGAGC AGG (reversed) Intergenic