ID: 1047113036

View in Genome Browser
Species Human (GRCh38)
Location 8:121812042-121812064
Sequence TGGTCACTTTTCCCATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047113031_1047113036 26 Left 1047113031 8:121811993-121812015 CCCTGCTCTGGCTTAGTGGTGGT No data
Right 1047113036 8:121812042-121812064 TGGTCACTTTTCCCATTTTCAGG No data
1047113029_1047113036 27 Left 1047113029 8:121811992-121812014 CCCCTGCTCTGGCTTAGTGGTGG No data
Right 1047113036 8:121812042-121812064 TGGTCACTTTTCCCATTTTCAGG No data
1047113032_1047113036 25 Left 1047113032 8:121811994-121812016 CCTGCTCTGGCTTAGTGGTGGTA No data
Right 1047113036 8:121812042-121812064 TGGTCACTTTTCCCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047113036 Original CRISPR TGGTCACTTTTCCCATTTTC AGG Intergenic