ID: 1047119572

View in Genome Browser
Species Human (GRCh38)
Location 8:121885980-121886002
Sequence CCGTGTGTGGTGGAGCACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047119568_1047119572 5 Left 1047119568 8:121885952-121885974 CCTTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG No data
1047119566_1047119572 7 Left 1047119566 8:121885950-121885972 CCCCTTCTCTACTAAAAATACAA 0: 2620
1: 185086
2: 202025
3: 119500
4: 67974
Right 1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG No data
1047119565_1047119572 26 Left 1047119565 8:121885931-121885953 CCTGGCTAACGTGGTGAAACCCC 0: 609
1: 21916
2: 124832
3: 186751
4: 169515
Right 1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG No data
1047119567_1047119572 6 Left 1047119567 8:121885951-121885973 CCCTTCTCTACTAAAAATACAAA 0: 3184
1: 256447
2: 190028
3: 89670
4: 55001
Right 1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG No data
1047119564_1047119572 30 Left 1047119564 8:121885927-121885949 CCAGCCTGGCTAACGTGGTGAAA 0: 172
1: 9570
2: 126871
3: 218755
4: 182847
Right 1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047119572 Original CRISPR CCGTGTGTGGTGGAGCACAC CGG Intergenic
No off target data available for this crispr