ID: 1047126556

View in Genome Browser
Species Human (GRCh38)
Location 8:121968638-121968660
Sequence GTGCCATTCCAAATACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047126554_1047126556 0 Left 1047126554 8:121968615-121968637 CCAATCTGAAAAGGCTACATATT 0: 32
1: 244
2: 594
3: 987
4: 1466
Right 1047126556 8:121968638-121968660 GTGCCATTCCAAATACATGGTGG No data
1047126552_1047126556 13 Left 1047126552 8:121968602-121968624 CCAAGTGAAATAGCCAATCTGAA No data
Right 1047126556 8:121968638-121968660 GTGCCATTCCAAATACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047126556 Original CRISPR GTGCCATTCCAAATACATGG TGG Intergenic
No off target data available for this crispr