ID: 1047136293

View in Genome Browser
Species Human (GRCh38)
Location 8:122082243-122082265
Sequence CAGAATTCCCTCTGGTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047136290_1047136293 -10 Left 1047136290 8:122082230-122082252 CCAGTGTTCCTGTCAGAATTCCC No data
Right 1047136293 8:122082243-122082265 CAGAATTCCCTCTGGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047136293 Original CRISPR CAGAATTCCCTCTGGTAGCA AGG Intergenic
No off target data available for this crispr