ID: 1047151166

View in Genome Browser
Species Human (GRCh38)
Location 8:122264741-122264763
Sequence AAAGAAAACACAACACAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047151166_1047151171 17 Left 1047151166 8:122264741-122264763 CCTGACTGTGTTGTGTTTTCTTT No data
Right 1047151171 8:122264781-122264803 ATGCAATGGTTAGAAGTGTTTGG No data
1047151166_1047151170 3 Left 1047151166 8:122264741-122264763 CCTGACTGTGTTGTGTTTTCTTT No data
Right 1047151170 8:122264767-122264789 GGTTTGGACACAACATGCAATGG No data
1047151166_1047151172 30 Left 1047151166 8:122264741-122264763 CCTGACTGTGTTGTGTTTTCTTT No data
Right 1047151172 8:122264794-122264816 AAGTGTTTGGAGTTCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047151166 Original CRISPR AAAGAAAACACAACACAGTC AGG (reversed) Intergenic