ID: 1047151171

View in Genome Browser
Species Human (GRCh38)
Location 8:122264781-122264803
Sequence ATGCAATGGTTAGAAGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047151166_1047151171 17 Left 1047151166 8:122264741-122264763 CCTGACTGTGTTGTGTTTTCTTT No data
Right 1047151171 8:122264781-122264803 ATGCAATGGTTAGAAGTGTTTGG No data
1047151164_1047151171 27 Left 1047151164 8:122264731-122264753 CCATCCAGTACCTGACTGTGTTG No data
Right 1047151171 8:122264781-122264803 ATGCAATGGTTAGAAGTGTTTGG No data
1047151165_1047151171 23 Left 1047151165 8:122264735-122264757 CCAGTACCTGACTGTGTTGTGTT No data
Right 1047151171 8:122264781-122264803 ATGCAATGGTTAGAAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047151171 Original CRISPR ATGCAATGGTTAGAAGTGTT TGG Intergenic