ID: 1047151172

View in Genome Browser
Species Human (GRCh38)
Location 8:122264794-122264816
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047151166_1047151172 30 Left 1047151166 8:122264741-122264763 CCTGACTGTGTTGTGTTTTCTTT No data
Right 1047151172 8:122264794-122264816 AAGTGTTTGGAGTTCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047151172 Original CRISPR AAGTGTTTGGAGTTCTCCCC TGG Intergenic