ID: 1047153779

View in Genome Browser
Species Human (GRCh38)
Location 8:122294634-122294656
Sequence CAGGCCCAATACCATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047153774_1047153779 4 Left 1047153774 8:122294607-122294629 CCTCTACGTTTGACTTCAGTGCA No data
Right 1047153779 8:122294634-122294656 CAGGCCCAATACCATGTGGAAGG No data
1047153772_1047153779 10 Left 1047153772 8:122294601-122294623 CCCAAACCTCTACGTTTGACTTC No data
Right 1047153779 8:122294634-122294656 CAGGCCCAATACCATGTGGAAGG No data
1047153773_1047153779 9 Left 1047153773 8:122294602-122294624 CCAAACCTCTACGTTTGACTTCA No data
Right 1047153779 8:122294634-122294656 CAGGCCCAATACCATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047153779 Original CRISPR CAGGCCCAATACCATGTGGA AGG Intergenic
No off target data available for this crispr