ID: 1047154516

View in Genome Browser
Species Human (GRCh38)
Location 8:122301943-122301965
Sequence TAGGAGAAGAACAGTGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047154511_1047154516 -2 Left 1047154511 8:122301922-122301944 CCTTCTCCAAATAACTTTGCCTA No data
Right 1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG No data
1047154510_1047154516 -1 Left 1047154510 8:122301921-122301943 CCCTTCTCCAAATAACTTTGCCT No data
Right 1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG No data
1047154513_1047154516 -8 Left 1047154513 8:122301928-122301950 CCAAATAACTTTGCCTAGGAGAA No data
Right 1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047154516 Original CRISPR TAGGAGAAGAACAGTGATGT GGG Intergenic
No off target data available for this crispr