ID: 1047155580

View in Genome Browser
Species Human (GRCh38)
Location 8:122313988-122314010
Sequence GTTAGGTTTTGCAAATGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047155580_1047155582 1 Left 1047155580 8:122313988-122314010 CCACGACATTTGCAAAACCTAAC No data
Right 1047155582 8:122314012-122314034 CAAATTACACATTTGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047155580 Original CRISPR GTTAGGTTTTGCAAATGTCG TGG (reversed) Intergenic
No off target data available for this crispr