ID: 1047156361

View in Genome Browser
Species Human (GRCh38)
Location 8:122323735-122323757
Sequence CTGAATATGAGGCAGTAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047156361_1047156363 -4 Left 1047156361 8:122323735-122323757 CCAGATTACTGCCTCATATTCAG No data
Right 1047156363 8:122323754-122323776 TCAGTTGCCCCAAATACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047156361 Original CRISPR CTGAATATGAGGCAGTAATC TGG (reversed) Intergenic
No off target data available for this crispr