ID: 1047159450

View in Genome Browser
Species Human (GRCh38)
Location 8:122361164-122361186
Sequence TCATCTCTCTCAGATCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047159449_1047159450 23 Left 1047159449 8:122361118-122361140 CCTCAGCTTGGTCTATTCTGCTT No data
Right 1047159450 8:122361164-122361186 TCATCTCTCTCAGATCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047159450 Original CRISPR TCATCTCTCTCAGATCAGTT TGG Intergenic
No off target data available for this crispr