ID: 1047161165

View in Genome Browser
Species Human (GRCh38)
Location 8:122381591-122381613
Sequence TGATTCCTGTGGAGCCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047161161_1047161165 24 Left 1047161161 8:122381544-122381566 CCCCTCATGAACTGGTTAAATAA No data
Right 1047161165 8:122381591-122381613 TGATTCCTGTGGAGCCCAAGAGG No data
1047161162_1047161165 23 Left 1047161162 8:122381545-122381567 CCCTCATGAACTGGTTAAATAAC No data
Right 1047161165 8:122381591-122381613 TGATTCCTGTGGAGCCCAAGAGG No data
1047161163_1047161165 22 Left 1047161163 8:122381546-122381568 CCTCATGAACTGGTTAAATAACA No data
Right 1047161165 8:122381591-122381613 TGATTCCTGTGGAGCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047161165 Original CRISPR TGATTCCTGTGGAGCCCAAG AGG Intergenic
No off target data available for this crispr