ID: 1047161634

View in Genome Browser
Species Human (GRCh38)
Location 8:122387008-122387030
Sequence TCCAGTTGGCCCCCAGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047161630_1047161634 -7 Left 1047161630 8:122386992-122387014 CCTCTAGAGCTTCAACTCCAGTT No data
Right 1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG No data
1047161629_1047161634 -4 Left 1047161629 8:122386989-122387011 CCTCCTCTAGAGCTTCAACTCCA No data
Right 1047161634 8:122387008-122387030 TCCAGTTGGCCCCCAGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047161634 Original CRISPR TCCAGTTGGCCCCCAGGCTC GGG Intergenic
No off target data available for this crispr