ID: 1047161634 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:122387008-122387030 |
| Sequence | TCCAGTTGGCCCCCAGGCTC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047161630_1047161634 | -7 | Left | 1047161630 | 8:122386992-122387014 | CCTCTAGAGCTTCAACTCCAGTT | No data | ||
| Right | 1047161634 | 8:122387008-122387030 | TCCAGTTGGCCCCCAGGCTCGGG | No data | ||||
| 1047161629_1047161634 | -4 | Left | 1047161629 | 8:122386989-122387011 | CCTCCTCTAGAGCTTCAACTCCA | No data | ||
| Right | 1047161634 | 8:122387008-122387030 | TCCAGTTGGCCCCCAGGCTCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047161634 | Original CRISPR | TCCAGTTGGCCCCCAGGCTC GGG | Intergenic | ||
| No off target data available for this crispr | |||||