ID: 1047173713

View in Genome Browser
Species Human (GRCh38)
Location 8:122520401-122520423
Sequence CATGACTAGCAAGTAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047173713_1047173718 21 Left 1047173713 8:122520401-122520423 CCTGTGCTTACTTGCTAGTCATG No data
Right 1047173718 8:122520445-122520467 ATGCCTTTACCTCTGTTGTTCGG No data
1047173713_1047173720 25 Left 1047173713 8:122520401-122520423 CCTGTGCTTACTTGCTAGTCATG No data
Right 1047173720 8:122520449-122520471 CTTTACCTCTGTTGTTCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047173713 Original CRISPR CATGACTAGCAAGTAAGCAC AGG (reversed) Intergenic
No off target data available for this crispr