ID: 1047174218

View in Genome Browser
Species Human (GRCh38)
Location 8:122525129-122525151
Sequence CCTTCCTCCTGCCCTGCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047174218_1047174221 11 Left 1047174218 8:122525129-122525151 CCTATTGCAGGGCAGGAGGAAGG No data
Right 1047174221 8:122525163-122525185 CCTATAGCTTCATTATGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047174218 Original CRISPR CCTTCCTCCTGCCCTGCAAT AGG (reversed) Intergenic
No off target data available for this crispr