ID: 1047177284

View in Genome Browser
Species Human (GRCh38)
Location 8:122553751-122553773
Sequence CTGTTTCAATGTAAGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047177272_1047177284 27 Left 1047177272 8:122553701-122553723 CCACGGACTGGTACCAGGGGTTA No data
Right 1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG No data
1047177278_1047177284 -1 Left 1047177278 8:122553729-122553751 CCCTGTTCTAGAAGGATCTCCAC No data
Right 1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG No data
1047177275_1047177284 14 Left 1047177275 8:122553714-122553736 CCAGGGGTTAGGGACCCCTGTTC 0: 3
1: 25
2: 163
3: 475
4: 872
Right 1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG No data
1047177279_1047177284 -2 Left 1047177279 8:122553730-122553752 CCTGTTCTAGAAGGATCTCCACT No data
Right 1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG No data
1047177277_1047177284 0 Left 1047177277 8:122553728-122553750 CCCCTGTTCTAGAAGGATCTCCA No data
Right 1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047177284 Original CRISPR CTGTTTCAATGTAAGAGGTG GGG Intergenic
No off target data available for this crispr