ID: 1047177505

View in Genome Browser
Species Human (GRCh38)
Location 8:122555465-122555487
Sequence CTGTAAATACAAAGGGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047177505_1047177510 30 Left 1047177505 8:122555465-122555487 CCAATCTCCCTTTGTATTTACAG No data
Right 1047177510 8:122555518-122555540 GCCCCAAGATGTATATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047177505 Original CRISPR CTGTAAATACAAAGGGAGAT TGG (reversed) Intergenic
No off target data available for this crispr