ID: 1047178617

View in Genome Browser
Species Human (GRCh38)
Location 8:122566288-122566310
Sequence TAGACTTGTTAGGAAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047178611_1047178617 9 Left 1047178611 8:122566256-122566278 CCAAGAAGCGTGTCCAAGAGCAA No data
Right 1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG No data
1047178614_1047178617 -4 Left 1047178614 8:122566269-122566291 CCAAGAGCAAGGGTTCCAATAGA No data
Right 1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047178617 Original CRISPR TAGACTTGTTAGGAAGCTGC AGG Intergenic
No off target data available for this crispr