ID: 1047180094

View in Genome Browser
Species Human (GRCh38)
Location 8:122579211-122579233
Sequence TGCCAGAACCAAAGTGCGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047180094_1047180097 13 Left 1047180094 8:122579211-122579233 CCTACCGCACTTTGGTTCTGGCA No data
Right 1047180097 8:122579247-122579269 TACACTGCCCAGTTCCCCTTTGG No data
1047180094_1047180098 16 Left 1047180094 8:122579211-122579233 CCTACCGCACTTTGGTTCTGGCA No data
Right 1047180098 8:122579250-122579272 ACTGCCCAGTTCCCCTTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047180094 Original CRISPR TGCCAGAACCAAAGTGCGGT AGG (reversed) Intergenic
No off target data available for this crispr