ID: 1047182176

View in Genome Browser
Species Human (GRCh38)
Location 8:122599475-122599497
Sequence CTTGAACTGCTGTTCTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047182173_1047182176 19 Left 1047182173 8:122599433-122599455 CCTCTGAGCAAAAAGGAATTCTG No data
Right 1047182176 8:122599475-122599497 CTTGAACTGCTGTTCTTTCATGG No data
1047182175_1047182176 -4 Left 1047182175 8:122599456-122599478 CCAGCAGACAGTCTCTGGACTTG No data
Right 1047182176 8:122599475-122599497 CTTGAACTGCTGTTCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047182176 Original CRISPR CTTGAACTGCTGTTCTTTCA TGG Intergenic
No off target data available for this crispr