ID: 1047183304

View in Genome Browser
Species Human (GRCh38)
Location 8:122609771-122609793
Sequence CTGGTCCTGCCTATGACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047183304_1047183310 -2 Left 1047183304 8:122609771-122609793 CCAAGTGTCATAGGCAGGACCAG No data
Right 1047183310 8:122609792-122609814 AGGTGGAGGTAATCGGATCATGG 0: 16
1: 216
2: 766
3: 2210
4: 4762
1047183304_1047183313 1 Left 1047183304 8:122609771-122609793 CCAAGTGTCATAGGCAGGACCAG No data
Right 1047183313 8:122609795-122609817 TGGAGGTAATCGGATCATGGGGG 0: 15
1: 191
2: 1039
3: 7482
4: 12078
1047183304_1047183312 0 Left 1047183304 8:122609771-122609793 CCAAGTGTCATAGGCAGGACCAG No data
Right 1047183312 8:122609794-122609816 GTGGAGGTAATCGGATCATGGGG 0: 18
1: 190
2: 705
3: 2564
4: 9611
1047183304_1047183308 -9 Left 1047183304 8:122609771-122609793 CCAAGTGTCATAGGCAGGACCAG No data
Right 1047183308 8:122609785-122609807 CAGGACCAGGTGGAGGTAATCGG 0: 54
1: 101
2: 172
3: 242
4: 437
1047183304_1047183311 -1 Left 1047183304 8:122609771-122609793 CCAAGTGTCATAGGCAGGACCAG No data
Right 1047183311 8:122609793-122609815 GGTGGAGGTAATCGGATCATGGG 0: 16
1: 186
2: 732
3: 2498
4: 8970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047183304 Original CRISPR CTGGTCCTGCCTATGACACT TGG (reversed) Intergenic
No off target data available for this crispr