ID: 1047183705

View in Genome Browser
Species Human (GRCh38)
Location 8:122613464-122613486
Sequence CAGAGTTTCCAGAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047183705_1047183707 3 Left 1047183705 8:122613464-122613486 CCATCTTCTCTCTGGAAACTCTG No data
Right 1047183707 8:122613490-122613512 CAAATTCTGCCTGTCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047183705 Original CRISPR CAGAGTTTCCAGAGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr