ID: 1047184092

View in Genome Browser
Species Human (GRCh38)
Location 8:122616437-122616459
Sequence GACAGAAGGAGGCAGGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047184092_1047184101 28 Left 1047184092 8:122616437-122616459 CCTATGCCCTGCCTCCTTCTGTC No data
Right 1047184101 8:122616488-122616510 CTATCAGAAATATAATCCCCTGG No data
1047184092_1047184102 29 Left 1047184092 8:122616437-122616459 CCTATGCCCTGCCTCCTTCTGTC No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184092_1047184097 -7 Left 1047184092 8:122616437-122616459 CCTATGCCCTGCCTCCTTCTGTC No data
Right 1047184097 8:122616453-122616475 TTCTGTCACCACATCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047184092 Original CRISPR GACAGAAGGAGGCAGGGCAT AGG (reversed) Intergenic
No off target data available for this crispr