ID: 1047184093

View in Genome Browser
Species Human (GRCh38)
Location 8:122616443-122616465
Sequence TGTGGTGACAGAAGGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047184093_1047184102 23 Left 1047184093 8:122616443-122616465 CCCTGCCTCCTTCTGTCACCACA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184093_1047184101 22 Left 1047184093 8:122616443-122616465 CCCTGCCTCCTTCTGTCACCACA No data
Right 1047184101 8:122616488-122616510 CTATCAGAAATATAATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047184093 Original CRISPR TGTGGTGACAGAAGGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr