ID: 1047184095

View in Genome Browser
Species Human (GRCh38)
Location 8:122616448-122616470
Sequence TGGGATGTGGTGACAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047184095_1047184101 17 Left 1047184095 8:122616448-122616470 CCTCCTTCTGTCACCACATCCCA No data
Right 1047184101 8:122616488-122616510 CTATCAGAAATATAATCCCCTGG No data
1047184095_1047184102 18 Left 1047184095 8:122616448-122616470 CCTCCTTCTGTCACCACATCCCA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047184095 Original CRISPR TGGGATGTGGTGACAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr