ID: 1047184096

View in Genome Browser
Species Human (GRCh38)
Location 8:122616451-122616473
Sequence TTCTGGGATGTGGTGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047184096_1047184102 15 Left 1047184096 8:122616451-122616473 CCTTCTGTCACCACATCCCAGAA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184096_1047184101 14 Left 1047184096 8:122616451-122616473 CCTTCTGTCACCACATCCCAGAA No data
Right 1047184101 8:122616488-122616510 CTATCAGAAATATAATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047184096 Original CRISPR TTCTGGGATGTGGTGACAGA AGG (reversed) Intergenic
No off target data available for this crispr