ID: 1047184098

View in Genome Browser
Species Human (GRCh38)
Location 8:122616461-122616483
Sequence TTGTTTTTCCTTCTGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047184098_1047184102 5 Left 1047184098 8:122616461-122616483 CCACATCCCAGAAGGAAAAACAA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184098_1047184101 4 Left 1047184098 8:122616461-122616483 CCACATCCCAGAAGGAAAAACAA No data
Right 1047184101 8:122616488-122616510 CTATCAGAAATATAATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047184098 Original CRISPR TTGTTTTTCCTTCTGGGATG TGG (reversed) Intergenic
No off target data available for this crispr