ID: 1047184102

View in Genome Browser
Species Human (GRCh38)
Location 8:122616489-122616511
Sequence TATCAGAAATATAATCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047184093_1047184102 23 Left 1047184093 8:122616443-122616465 CCCTGCCTCCTTCTGTCACCACA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184096_1047184102 15 Left 1047184096 8:122616451-122616473 CCTTCTGTCACCACATCCCAGAA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184092_1047184102 29 Left 1047184092 8:122616437-122616459 CCTATGCCCTGCCTCCTTCTGTC No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184095_1047184102 18 Left 1047184095 8:122616448-122616470 CCTCCTTCTGTCACCACATCCCA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184099_1047184102 -1 Left 1047184099 8:122616467-122616489 CCCAGAAGGAAAAACAAATAACT No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184098_1047184102 5 Left 1047184098 8:122616461-122616483 CCACATCCCAGAAGGAAAAACAA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184094_1047184102 22 Left 1047184094 8:122616444-122616466 CCTGCCTCCTTCTGTCACCACAT No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data
1047184100_1047184102 -2 Left 1047184100 8:122616468-122616490 CCAGAAGGAAAAACAAATAACTA No data
Right 1047184102 8:122616489-122616511 TATCAGAAATATAATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047184102 Original CRISPR TATCAGAAATATAATCCCCT GGG Intergenic
No off target data available for this crispr