ID: 1047188431

View in Genome Browser
Species Human (GRCh38)
Location 8:122656496-122656518
Sequence GATGCTGGTACCCCACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047188431_1047188437 10 Left 1047188431 8:122656496-122656518 CCATGAGGTGGGGTACCAGCATC No data
Right 1047188437 8:122656529-122656551 TCAGTGGTGGTCATCCTCTGTGG No data
1047188431_1047188436 -3 Left 1047188431 8:122656496-122656518 CCATGAGGTGGGGTACCAGCATC No data
Right 1047188436 8:122656516-122656538 ATCACTGGGATGTTCAGTGGTGG No data
1047188431_1047188438 11 Left 1047188431 8:122656496-122656518 CCATGAGGTGGGGTACCAGCATC No data
Right 1047188438 8:122656530-122656552 CAGTGGTGGTCATCCTCTGTGGG No data
1047188431_1047188435 -6 Left 1047188431 8:122656496-122656518 CCATGAGGTGGGGTACCAGCATC No data
Right 1047188435 8:122656513-122656535 AGCATCACTGGGATGTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047188431 Original CRISPR GATGCTGGTACCCCACCTCA TGG (reversed) Intergenic
No off target data available for this crispr