ID: 1047191316

View in Genome Browser
Species Human (GRCh38)
Location 8:122681481-122681503
Sequence AAAATGCAGCCGGAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047191316_1047191321 -10 Left 1047191316 8:122681481-122681503 CCCATCTCCTCCGGCTGCATTTT No data
Right 1047191321 8:122681494-122681516 GCTGCATTTTCCCCACCTCTGGG No data
1047191316_1047191327 11 Left 1047191316 8:122681481-122681503 CCCATCTCCTCCGGCTGCATTTT No data
Right 1047191327 8:122681515-122681537 GGGAGCACCTCTGTTCCAGAAGG No data
1047191316_1047191322 -9 Left 1047191316 8:122681481-122681503 CCCATCTCCTCCGGCTGCATTTT No data
Right 1047191322 8:122681495-122681517 CTGCATTTTCCCCACCTCTGGGG No data
1047191316_1047191329 22 Left 1047191316 8:122681481-122681503 CCCATCTCCTCCGGCTGCATTTT No data
Right 1047191329 8:122681526-122681548 TGTTCCAGAAGGCTCTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047191316 Original CRISPR AAAATGCAGCCGGAGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr