ID: 1047192054

View in Genome Browser
Species Human (GRCh38)
Location 8:122687139-122687161
Sequence GCGTTTAAGTAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047192054_1047192059 -9 Left 1047192054 8:122687139-122687161 CCTTCTTCCCTCTACTTAAACGC No data
Right 1047192059 8:122687153-122687175 CTTAAACGCTCCTCCCCCAGGGG No data
1047192054_1047192058 -10 Left 1047192054 8:122687139-122687161 CCTTCTTCCCTCTACTTAAACGC No data
Right 1047192058 8:122687152-122687174 ACTTAAACGCTCCTCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047192054 Original CRISPR GCGTTTAAGTAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr